wild type pak4 plasmid Search Results


94
Genecopoeia human pak4
Human Pak4, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/Promoter+reporter+clone+for+Human+PAK4/pm23790167-76-18-26
Average 94 stars, based on 1 article reviews
human pak4 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
Shanghai GenePharma p21-activated kinase 4 (pak4) overexpression plasmid pcdna3.1-pak4 (pc-pak4)
P21 Activated Kinase 4 (Pak4) Overexpression Plasmid Pcdna3.1 Pak4 (Pc Pak4), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/mir+663b+mimics/10__2147_slash_ott__s254662-66-1-12
Average 90 stars, based on 1 article reviews
p21-activated kinase 4 (pak4) overexpression plasmid pcdna3.1-pak4 (pc-pak4) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

91
Addgene inc pak4 expressing adenovirus
Fig. 2 | Forced overexpression of <t>PAK4</t> in mouse liver attenuates ketogenic responses. Eight-week-old male C57BL/6 mice were injected with <t>adenoviruses</t> expressing control (AdLacZ), PAK4 (AdPAK4), or kinase-inactive mutant PAK4S474A
Pak4 Expressing Adenovirus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+(Plasmid+%2339137)/pm37591884-346-2-14
Average 91 stars, based on 1 article reviews
pak4 expressing adenovirus - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

94
Carna Inc gst rock1 catalytic domain
Representative confocal micrographs of co‐cultures of wild‐type (WT) and LUZP1 knockout (LUZP1 KO) Eph4 cells in the apical plane. Scale bar, 10 μm. Bar plots with dot density plots showing that <t>ROCK1</t> mean intensities within circumferential rings (CRs) are similar between WT and LUZP1 KO cells (40.87 ± 9.95 arbitrary units [a.u.] [WT] vs. 39.48 ± 6.04 a.u. [LUZP1 KO]). n = 3. P = 0.54 (Mann–Whitney U test). Bars and error bars represent the mean ± standard deviation (SD). In vitro myosin light chain (MLC) phosphorylation assay using 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, and 0–5 μg GST‐LUZP1. Quantification of the ppMLC/MLC ratio relative to the control showed that LUZP1 did not change the ratio (1.00 [1 st lane, control] vs. 1.13 ± 0.24 [2 nd lane] vs. 1.01 ± 0.44 [3 rd lane] vs. 1.08 ± 0.73 [4 th lane]). n = 4. P = 0.49 (Kruskal–Wallis test). Bars and error bars represent the mean ± SD. IB, immunoblotting. Representative confocal micrographs of co‐cultures of Venus‐LUZP1‐expressing LUZP1 KO (REV) and LUZP1 KO Eph4 cells treated with 100 nM calyculin A for 30 min. Scale bar, 10 μm. Bar plots with dot density plots showing that calyculin A reversed the difference in ppMLC levels within CRs between REV and LUZP1 KO cells (control, 21.14 ± 16.80 a.u. [WT] vs. 3.10 ± 1.72 a.u. [LUZP1 KO]; calyculin A, 25.24 ± 10.54 a.u. [WT] vs. 20.65 ± 5.62 a.u. [LUZP1 KO]; washout, 22.09 ± 7.90 a.u. [WT] vs. 7.92 ± 4.01 a.u. [LUZP1 KO]). ** P < 0.01 (Mann–Whitney U test). Bars and error bars represent the mean ± SD. n = 3. Representative immunoblot of WT, LUZP1 KO, and Venus‐LUZP1‐expressing LUZP1 knockout (REV) Eph4 cells treated with 100 nM calyculin A for 30 min. Quantification of the ppMLC/MLC ratio relative to WT control, confirming the reversal of the difference in ppMLC levels within CRs between WT and LUZP1 KO cells by calyculin A (WT, 1.00 [control] vs. 1.40 ± 0.06 [calyculin A] vs. 1.14 ± 0.33 [washout]; KO, 0.09 ± 0.04 [control] vs. 1.49 ± 0.06 [calyculin A] vs. 0.81 ± 0.99 [washout]; REV, 2.06 ± 1.78 [control] vs. 1.82 ± 1.50 [calyculin A] vs. 1.80 ± 1.14 [washout]). n = 3. Bars and error bars represent the mean ± SD. Source data are available online for this figure.
Gst Rock1 Catalytic Domain, supplied by Carna Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/ROCK1/pmc07809799-113-0-3
Average 94 stars, based on 1 article reviews
gst rock1 catalytic domain - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene full length gfp tagged pak4 overexpression plasmid pak4 fl
Figure 1. Effects of <t>PAK4</t> <t>overexpression</t> and knockdown on mesenchymal transition in glioma cells. (a) Western blot analysis of 4910 and U251 glioma cells transfected with EV and PAK4-FL for 48 h along with untreated controls and GAPDH served as a loading control. (b) Representative micrographs of morphological characteristics in EV- or PAK4-FL-treated glioma cells after 48 h transfection. Scale bars: 10 μm. (c) Representative immunoblots from three independent experiments using whole cell lysates of glioma cells transfected with EV or PAK4-FL to assess changes in EMT markers. (d) Immunoblot analysis of effects of PAK4 downregulation using PAK4shRNA when compared with untreated and SV controls in 4910 and U251 cells. (e) Phase contrast micrographs of morphological characteristics of 4910 and U251 cells after SV and PAK4sh treatments for 48 h. Scale bars: 10 μm. (f) Confocal microscopy showing E-cadherin (green) and N-cadherin (red) expression in control, SV- and PAK4sh-treated cells. DAPI was used for nuclear counterstaining. Scale bars: 10 μm.
Full Length Gfp Tagged Pak4 Overexpression Plasmid Pak4 Fl, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+(NM_005884)+Human+Tagged+ORF+Clone/pm28534509-158-27-33
Average 90 stars, based on 1 article reviews
full length gfp tagged pak4 overexpression plasmid pak4 fl - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology pak4
Primer sequences used for a quantitative real-time polymerase chain reaction.
Pak4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+Antibody/pmc11394300-103-9-11
Average 93 stars, based on 1 article reviews
pak4 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc polyclonal pak4 antibody
Fig. 1 – Morphology of wild-type (+/+) and <t>Pak4</t> homozygous mutant (/) embryos. (A) The Pak4/ embryo is developmentally retarded and smaller than its Pak4+/+ littermate (E10.5). (B) Analysis of cell proliferation (a) and apoptosis (b) in E9.5 Pak4+/+ and Pak4/ embryos. (a) Immunostaining with Ki67 antibody (brown) shows high level of proliferation throughout the Pak4+/+ embryo, and the highest level in the neural tissue indicated by arrows; whereas dramatically decreased proliferation was observed in Pak4-null embryos at this stage. Lower panel shows higher magnification of the boxed areas in upper panel. (b) Apoptosis detected by cleaved caspase-3 level (brown) was increased in Pak4/ embryo, especially in the neural tissue indicated by arrowheads, compared to Pak4+/+ embryo. Lower panel shows higher magnification of the boxed areas in upper panel. (C) Extraembryonic tissues of Pak4+/+ and Pak4/ embryos at E10.5. Note that the vitelline vessels visible in the Pak4+/+ yolk sac are missing in the Pak4/ yolk sac and that the Pak4/ placenta contains less blood and looks paler than the Pak4+/+ placenta. (D) Pak4 expression in extraembryonic tissues. FP, fetal placenta; MP, maternal placenta; YS, yolk sac; WT, wild-type mouse embryonic fibroblast (MEF) control; KO, Pak4/ MEF control.
Polyclonal Pak4 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+(G222)+Antibody/pm19464366-234-6-10
Average 94 stars, based on 1 article reviews
polyclonal pak4 antibody - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene pak4 plasmid
(A) Baseline miR-199a-3p levels in levels in human esophageal cell lines and human samples. (A, a) Endogenous relative miR-199a-3p expression levels in human esophageal cell lines as examined by q-PCR. MiR-199a-3p levels of human esophageal cancer cell lines (TE7, TE10 and FLO-1) were compared to miR-199a-3p levels of human esophageal epithelial cells (hESO). Total RNA was isolated from cells, followed by RT-q-PCR. Levels of miR-199a-3p were normalized with small nuclear RNA U6. A representative experiment of three independent experiments is shown. Error bars represents ± S.D. and statistical significance based on a two-tailed Student’s t test is indicated by * (p < 0.001). (A, b) Copy numbers of miR-199a-3p in esophageal cell lines shown in (A, a). (A, c) Copy numbers of miR-199a-3p in human esophageal cancer samples and matched benign esophageal epithelium. The copy numbers were measured using droplet digital PCR (dd PCR) technique and the concentration of miR was calculated in copies per microliter in each cell line and human specimen. (B) Levels of <t>PAK4</t> are inversely correlated with miR-199a-3p levels. (B, a) Relative PAK4 mRNA levels in human esophageal cancer cell lines compared to hESO cells as examined by q-PCR. Levels of PAK4 mRNA for each cell line are normalized with GAPDH mRNA levels. Statistical significance is indicated by * (p < 0.001). (B, b) Copy numbers of PAK4 mRNA in esophageal cell lines shown in (B, a) measured by dd-PCR. (B, c) Copy numbers of PAK4 mRNA in human esophageal cancer samples and matched benign esophageal epithelium measured by dd-PCR. (B, d) Representative immunoblot forendogenous PAK4 protein levels in human esophageal cell lines shown in (B, a) GAPDH was used as a loading control. S.I. = Relative PAK4 protein mean signal intensity. Signal intensity of the target proteins is determined by densitometry and is normalized by signal intensity of GAPDH. Relative signal intensity (SI) for target protein is calculated compare to hESO.
Pak4 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/Pak4+Rat+shRNA+Plasmid/pmc06033339-146-4-6
Average 90 stars, based on 1 article reviews
pak4 plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

96
Carna Inc human clk1
( a ) TG693 and TG003 chemical structures. ( b ) Pharmacokinetic profile of TG693 after a single 30 mg kg −1 dose administered by subcutaneous injection in imprinting control region (ICR) mice. Data indicate the mean ± SEM (n = 3). ( c ) Recombinant <t>CLK1</t> was incubated with the substrate peptide in the presence of the indicated concentrations of small molecules. Data represent the means ± SD (n = 3). Representative dose-response curves with Hill slopes are shown. ( d ) TG693 competitive ATP inhibition is shown in Michaelis-Menten (left) and Hanes-Woolf (right) plots. <t>CLK1</t> <t>kinase</t> activity was measured at the indicated concentrations of TG693 and ATP. Velocity was plotted versus [ATP] and [ATP]/velocity was plotted versus [ATP]. ( e ) Map of the inhibitory activities of TG693 on a kinase dendrogram. Percent inhibition by 1 μM TG693 was measured for a panel of 313 kinases. Red circles indicate the inhibited kinases and are sized according to percent inhibition. The illustration was reproduced courtesy of Cell Signaling Technology, Inc. ( www.cellsignal.com ).
Human Clk1, supplied by Carna Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/CLK1/pmc05448077-80-38-42
Average 96 stars, based on 1 article reviews
human clk1 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

91
Addgene inc guide rna sequence
ECs isolated from three human GBM tumors (patients 5377, 5391 and 5465) were transduced to express CRISPR sgRNA targeting PAK4 or a <t>random</t> <t>sequence.</t> Stable sgRNA-expressing ECs were harvested by flow cytometry sorting. a–g, <t>RNA</t> was extracted and subjected to transcriptome analysis by RNA-seq. a, Expression of PAK genes. Top, immunoblot analysis. Bottom, RNA-seq analysis, with quantificaton below (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). FPKM, fragments per kilobase of transcript per million mapped reads. b, t-distributed stochastic neighbor embedding (t-SNE) analysis of all of the mapped genes. c, Global change profiles in RNA expression. d, Heat map for genes with altered expression (change > 50%), as determined by RNA-seq. e, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. f, RNA was isolated and analyzed by quantitative RT-PCR. The results were normalized to GAPDH expression (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. mRNA, messenger RNA. g, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. h, Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results.
Guide Rna Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+gRNA+(BRDN0001147629)+(Plasmid+%2377573)/pmc10097424-516-76-88
Average 91 stars, based on 1 article reviews
guide rna sequence - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology pak4crispr cas9 ko plasmid
ECs isolated from three human GBM tumors (patients 5377, 5391 and 5465) were transduced to express CRISPR sgRNA targeting PAK4 or a <t>random</t> <t>sequence.</t> Stable sgRNA-expressing ECs were harvested by flow cytometry sorting. a–g, <t>RNA</t> was extracted and subjected to transcriptome analysis by RNA-seq. a, Expression of PAK genes. Top, immunoblot analysis. Bottom, RNA-seq analysis, with quantificaton below (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). FPKM, fragments per kilobase of transcript per million mapped reads. b, t-distributed stochastic neighbor embedding (t-SNE) analysis of all of the mapped genes. c, Global change profiles in RNA expression. d, Heat map for genes with altered expression (change > 50%), as determined by RNA-seq. e, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. f, RNA was isolated and analyzed by quantitative RT-PCR. The results were normalized to GAPDH expression (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. mRNA, messenger RNA. g, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. h, Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results.
Pak4crispr Cas9 Ko Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/PAK4+CRISPR%2FCas9+KO+Plasmid/pm29983868-167-6-9
Average 90 stars, based on 1 article reviews
pak4crispr cas9 ko plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
Genecopoeia shrna constructs against human pak4
(A-B) E 2 induces <t>Pak4</t> mRNA and protein levels. Serum-starved Ishikawa, RL95-2 and MCF-7 cells were treated with 10 nM E 2 , and cells were harvested at the indicated time. (A) The levels of Pak4 mRNA were determined by qRT-PCR, using β-actin as an internal control. Values represent mean ± s.d. (n = 3). *** P <0.001 compared with control. (B) The protein levels of Pak4 were assessed by Western blot. (C) Ishikawa and RL95-2 cells were serum-starved for 24 h, and then treated with 10 nM E 2 for indicated times. The levels of p-Pak4ser 474 were measured by Western blot, using β-actin as a loading control. All experiments were carried out in triplicates.
Shrna Constructs Against Human Pak4, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/wild+type+pak4+plasmid/shRNA+clone+set+against+Human+PAK4/pmc05620238-106-13-23
Average 94 stars, based on 1 article reviews
shrna constructs against human pak4 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Fig. 2 | Forced overexpression of PAK4 in mouse liver attenuates ketogenic responses. Eight-week-old male C57BL/6 mice were injected with adenoviruses expressing control (AdLacZ), PAK4 (AdPAK4), or kinase-inactive mutant PAK4S474A

Journal: Nature communications

Article Title: p21-activated kinase 4 suppresses fatty acid β-oxidation and ketogenesis by phosphorylating NCoR1.

doi: 10.1038/s41467-023-40597-z

Figure Lengend Snippet: Fig. 2 | Forced overexpression of PAK4 in mouse liver attenuates ketogenic responses. Eight-week-old male C57BL/6 mice were injected with adenoviruses expressing control (AdLacZ), PAK4 (AdPAK4), or kinase-inactive mutant PAK4S474A

Article Snippet: To prepare PAK4 expressing adenovirus, the mouse PAK4 cDNA was inserted into pAdTrack-CMV vector (Addgene, Watertown, MA, USA).

Techniques: Over Expression, Injection, Expressing, Control, Mutagenesis

Fig. 3 | Hepatocyte-specific PAK4 deficiency enhances ketogenic responses. a Gene set enrichment analysis plots of RNA-Seq data. Eight-week-old male Pak4 LKO and WT mice were fasted for 24 h, and RNA samples from liver tissues were subjected to RNA-Seq. b Representative IVIS images of in vivo luciferase activity after injection with adenovirus expressing HMGCS2-luciferase in Pak4 LKO and WT mice (n = 3 for Fed and Fast groups and n = 7 for KD group). c–g Pak4 LKO and WT mice were fed a normal chow ad libitum (Fed), fasted for 24 h (Fast), or fed a ketogenic diet (KD) for 2 weeks. Blood levels of βOHB (c, n = 5), TG levels in the liver

Journal: Nature communications

Article Title: p21-activated kinase 4 suppresses fatty acid β-oxidation and ketogenesis by phosphorylating NCoR1.

doi: 10.1038/s41467-023-40597-z

Figure Lengend Snippet: Fig. 3 | Hepatocyte-specific PAK4 deficiency enhances ketogenic responses. a Gene set enrichment analysis plots of RNA-Seq data. Eight-week-old male Pak4 LKO and WT mice were fasted for 24 h, and RNA samples from liver tissues were subjected to RNA-Seq. b Representative IVIS images of in vivo luciferase activity after injection with adenovirus expressing HMGCS2-luciferase in Pak4 LKO and WT mice (n = 3 for Fed and Fast groups and n = 7 for KD group). c–g Pak4 LKO and WT mice were fed a normal chow ad libitum (Fed), fasted for 24 h (Fast), or fed a ketogenic diet (KD) for 2 weeks. Blood levels of βOHB (c, n = 5), TG levels in the liver

Article Snippet: To prepare PAK4 expressing adenovirus, the mouse PAK4 cDNA was inserted into pAdTrack-CMV vector (Addgene, Watertown, MA, USA).

Techniques: RNA Sequencing, In Vivo, Luciferase, Activity Assay, Injection, Expressing

Fig. 7 | Tumor overexpression of PAK4 is associated with reduced ketogenesis in hepatocellular carcinoma (HCC) patients. a, b Kaplan–Meier survival curves are shown for overall survival (OS, a) and relapse-free survival (RFS, b) based on the expression of PAK4 and HMGCS2 in HCC patients. c Immunoblot analysis was performed for the indicated proteins in non-tumor (N) and tumor (T) liver tissues obtained from HCC patients (n = 30). NCoR1 phosphorylation was analyzed by immunoblotting with anti-p-Ser/Thr antibody following immunoprecipitation with anti-NCoR1 antibody. Protein density was quantified. d βOHB levels were measured

Journal: Nature communications

Article Title: p21-activated kinase 4 suppresses fatty acid β-oxidation and ketogenesis by phosphorylating NCoR1.

doi: 10.1038/s41467-023-40597-z

Figure Lengend Snippet: Fig. 7 | Tumor overexpression of PAK4 is associated with reduced ketogenesis in hepatocellular carcinoma (HCC) patients. a, b Kaplan–Meier survival curves are shown for overall survival (OS, a) and relapse-free survival (RFS, b) based on the expression of PAK4 and HMGCS2 in HCC patients. c Immunoblot analysis was performed for the indicated proteins in non-tumor (N) and tumor (T) liver tissues obtained from HCC patients (n = 30). NCoR1 phosphorylation was analyzed by immunoblotting with anti-p-Ser/Thr antibody following immunoprecipitation with anti-NCoR1 antibody. Protein density was quantified. d βOHB levels were measured

Article Snippet: To prepare PAK4 expressing adenovirus, the mouse PAK4 cDNA was inserted into pAdTrack-CMV vector (Addgene, Watertown, MA, USA).

Techniques: Over Expression, Expressing, Western Blot, Phospho-proteomics, Immunoprecipitation

Representative confocal micrographs of co‐cultures of wild‐type (WT) and LUZP1 knockout (LUZP1 KO) Eph4 cells in the apical plane. Scale bar, 10 μm. Bar plots with dot density plots showing that ROCK1 mean intensities within circumferential rings (CRs) are similar between WT and LUZP1 KO cells (40.87 ± 9.95 arbitrary units [a.u.] [WT] vs. 39.48 ± 6.04 a.u. [LUZP1 KO]). n = 3. P = 0.54 (Mann–Whitney U test). Bars and error bars represent the mean ± standard deviation (SD). In vitro myosin light chain (MLC) phosphorylation assay using 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, and 0–5 μg GST‐LUZP1. Quantification of the ppMLC/MLC ratio relative to the control showed that LUZP1 did not change the ratio (1.00 [1 st lane, control] vs. 1.13 ± 0.24 [2 nd lane] vs. 1.01 ± 0.44 [3 rd lane] vs. 1.08 ± 0.73 [4 th lane]). n = 4. P = 0.49 (Kruskal–Wallis test). Bars and error bars represent the mean ± SD. IB, immunoblotting. Representative confocal micrographs of co‐cultures of Venus‐LUZP1‐expressing LUZP1 KO (REV) and LUZP1 KO Eph4 cells treated with 100 nM calyculin A for 30 min. Scale bar, 10 μm. Bar plots with dot density plots showing that calyculin A reversed the difference in ppMLC levels within CRs between REV and LUZP1 KO cells (control, 21.14 ± 16.80 a.u. [WT] vs. 3.10 ± 1.72 a.u. [LUZP1 KO]; calyculin A, 25.24 ± 10.54 a.u. [WT] vs. 20.65 ± 5.62 a.u. [LUZP1 KO]; washout, 22.09 ± 7.90 a.u. [WT] vs. 7.92 ± 4.01 a.u. [LUZP1 KO]). ** P < 0.01 (Mann–Whitney U test). Bars and error bars represent the mean ± SD. n = 3. Representative immunoblot of WT, LUZP1 KO, and Venus‐LUZP1‐expressing LUZP1 knockout (REV) Eph4 cells treated with 100 nM calyculin A for 30 min. Quantification of the ppMLC/MLC ratio relative to WT control, confirming the reversal of the difference in ppMLC levels within CRs between WT and LUZP1 KO cells by calyculin A (WT, 1.00 [control] vs. 1.40 ± 0.06 [calyculin A] vs. 1.14 ± 0.33 [washout]; KO, 0.09 ± 0.04 [control] vs. 1.49 ± 0.06 [calyculin A] vs. 0.81 ± 0.99 [washout]; REV, 2.06 ± 1.78 [control] vs. 1.82 ± 1.50 [calyculin A] vs. 1.80 ± 1.14 [washout]). n = 3. Bars and error bars represent the mean ± SD. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: A microtubule‐LUZP1 association around tight junction promotes epithelial cell apical constriction

doi: 10.15252/embj.2020104712

Figure Lengend Snippet: Representative confocal micrographs of co‐cultures of wild‐type (WT) and LUZP1 knockout (LUZP1 KO) Eph4 cells in the apical plane. Scale bar, 10 μm. Bar plots with dot density plots showing that ROCK1 mean intensities within circumferential rings (CRs) are similar between WT and LUZP1 KO cells (40.87 ± 9.95 arbitrary units [a.u.] [WT] vs. 39.48 ± 6.04 a.u. [LUZP1 KO]). n = 3. P = 0.54 (Mann–Whitney U test). Bars and error bars represent the mean ± standard deviation (SD). In vitro myosin light chain (MLC) phosphorylation assay using 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, and 0–5 μg GST‐LUZP1. Quantification of the ppMLC/MLC ratio relative to the control showed that LUZP1 did not change the ratio (1.00 [1 st lane, control] vs. 1.13 ± 0.24 [2 nd lane] vs. 1.01 ± 0.44 [3 rd lane] vs. 1.08 ± 0.73 [4 th lane]). n = 4. P = 0.49 (Kruskal–Wallis test). Bars and error bars represent the mean ± SD. IB, immunoblotting. Representative confocal micrographs of co‐cultures of Venus‐LUZP1‐expressing LUZP1 KO (REV) and LUZP1 KO Eph4 cells treated with 100 nM calyculin A for 30 min. Scale bar, 10 μm. Bar plots with dot density plots showing that calyculin A reversed the difference in ppMLC levels within CRs between REV and LUZP1 KO cells (control, 21.14 ± 16.80 a.u. [WT] vs. 3.10 ± 1.72 a.u. [LUZP1 KO]; calyculin A, 25.24 ± 10.54 a.u. [WT] vs. 20.65 ± 5.62 a.u. [LUZP1 KO]; washout, 22.09 ± 7.90 a.u. [WT] vs. 7.92 ± 4.01 a.u. [LUZP1 KO]). ** P < 0.01 (Mann–Whitney U test). Bars and error bars represent the mean ± SD. n = 3. Representative immunoblot of WT, LUZP1 KO, and Venus‐LUZP1‐expressing LUZP1 knockout (REV) Eph4 cells treated with 100 nM calyculin A for 30 min. Quantification of the ppMLC/MLC ratio relative to WT control, confirming the reversal of the difference in ppMLC levels within CRs between WT and LUZP1 KO cells by calyculin A (WT, 1.00 [control] vs. 1.40 ± 0.06 [calyculin A] vs. 1.14 ± 0.33 [washout]; KO, 0.09 ± 0.04 [control] vs. 1.49 ± 0.06 [calyculin A] vs. 0.81 ± 0.99 [washout]; REV, 2.06 ± 1.78 [control] vs. 1.82 ± 1.50 [calyculin A] vs. 1.80 ± 1.14 [washout]). n = 3. Bars and error bars represent the mean ± SD. Source data are available online for this figure.

Article Snippet: GST‐ROCK1‐catalytic domain , Carna biosciences , Cat#01‐109.

Techniques: Knock-Out, MANN-WHITNEY, Standard Deviation, In Vitro, Phosphorylation Assay, Western Blot, Expressing

A schematic drawing of myosin phosphatase. Myosin phosphatase consists of PP1c β/δ, myosin phosphatase targeting subunit 1 (MYPT1), and a small 20‐kDa regulatory subunit (M20). PP1c β/δ represents a catalytic subunit responsible for dephosphorylating myosin light chain (MLC), whereas MYPT1 targets myosin phosphatase to MLC by binding both PP1c β/δ and MLC. Representative confocal micrographs of co‐cultures of wild‐type (WT) and LUZP1 knockout (LUZP1 KO) Eph4 cells in the apical plane. Scale bar, 10 μm. Bar plots with dot density plots showing that PP1c mean intensities within CRs are similar between WT and LUZP1 KO cells (28.68 ± 9.60 arbitrary units [a.u.] [WT] vs. 25.04 ± 9.47 a.u. [LUZP1 KO]). P = 0.09 [Mann–Whitney U test]. n = 3. Bars and error bars represent the mean ± standard deviation (SD). Co‐immunoprecipitation of HA‐PP1c β/δ and GFP‐LUZP1. LUZP1 binds to PP1c β/δ. IB, immunoblotting. In vitro MLC phosphorylation assay using 1 μg GST‐PP1c β/δ in addition to 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, and 0–5 μg GST‐LUZP1. Quantification of the di‐phosphorylated MLC (ppMLC)/MLC ratio relative to the control showed that LUZP1 upregulated ppMLC/MLC levels in a dose‐dependent manner (1.00 [1 st lane, control] vs. 1.27 ± 0.33 [2 nd lane] vs. 1.76 ± 0.68 [3 rd lane] vs. 2.53 ± 1.65 [4 th lane] vs. 2.93 ± 2.45 [5 th lane]). n = 3 or 6. ** P < 0.01 (Kruskal–Wallis test followed by Steel test [compared with 1 st lane]). Bars and error bars represent the mean ± SD. In vitro Merlin phosphorylation assay using 1 μg GST‐PP1c β/δ, 100 ng GST‐Merlin, 2 pg p21‐activated kinase 1 (PAK1), and 5 μg GST‐LUZP1. Quantification of the phosphorylated Merlin (pMerlin)/Merlin ratio relative to the control showed that LUZP1 upregulated pMerlin/Merlin levels (0.23 ± 0.15 [1 st lane] vs. 1.00 [2 nd lane, control] vs. 0.32 ± 0.17 [3 rd lane] vs. 0.97 ± 0.42 [4 th lane] vs. 1.25 ± 0.39 [5 th lane]). n = 4 or 9. * P < 0.05, ** P < 0.01 (Kruskal–Wallis test followed by Steel test [compared with 3 rd lane]). Bars and error bars represent the mean ± SD. A schematic drawing of the relationships among ppMLC, LUZP1, and myosin phosphatase at tight junction (TJ)‐associated CRs to promote apical constriction. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: A microtubule‐LUZP1 association around tight junction promotes epithelial cell apical constriction

doi: 10.15252/embj.2020104712

Figure Lengend Snippet: A schematic drawing of myosin phosphatase. Myosin phosphatase consists of PP1c β/δ, myosin phosphatase targeting subunit 1 (MYPT1), and a small 20‐kDa regulatory subunit (M20). PP1c β/δ represents a catalytic subunit responsible for dephosphorylating myosin light chain (MLC), whereas MYPT1 targets myosin phosphatase to MLC by binding both PP1c β/δ and MLC. Representative confocal micrographs of co‐cultures of wild‐type (WT) and LUZP1 knockout (LUZP1 KO) Eph4 cells in the apical plane. Scale bar, 10 μm. Bar plots with dot density plots showing that PP1c mean intensities within CRs are similar between WT and LUZP1 KO cells (28.68 ± 9.60 arbitrary units [a.u.] [WT] vs. 25.04 ± 9.47 a.u. [LUZP1 KO]). P = 0.09 [Mann–Whitney U test]. n = 3. Bars and error bars represent the mean ± standard deviation (SD). Co‐immunoprecipitation of HA‐PP1c β/δ and GFP‐LUZP1. LUZP1 binds to PP1c β/δ. IB, immunoblotting. In vitro MLC phosphorylation assay using 1 μg GST‐PP1c β/δ in addition to 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, and 0–5 μg GST‐LUZP1. Quantification of the di‐phosphorylated MLC (ppMLC)/MLC ratio relative to the control showed that LUZP1 upregulated ppMLC/MLC levels in a dose‐dependent manner (1.00 [1 st lane, control] vs. 1.27 ± 0.33 [2 nd lane] vs. 1.76 ± 0.68 [3 rd lane] vs. 2.53 ± 1.65 [4 th lane] vs. 2.93 ± 2.45 [5 th lane]). n = 3 or 6. ** P < 0.01 (Kruskal–Wallis test followed by Steel test [compared with 1 st lane]). Bars and error bars represent the mean ± SD. In vitro Merlin phosphorylation assay using 1 μg GST‐PP1c β/δ, 100 ng GST‐Merlin, 2 pg p21‐activated kinase 1 (PAK1), and 5 μg GST‐LUZP1. Quantification of the phosphorylated Merlin (pMerlin)/Merlin ratio relative to the control showed that LUZP1 upregulated pMerlin/Merlin levels (0.23 ± 0.15 [1 st lane] vs. 1.00 [2 nd lane, control] vs. 0.32 ± 0.17 [3 rd lane] vs. 0.97 ± 0.42 [4 th lane] vs. 1.25 ± 0.39 [5 th lane]). n = 4 or 9. * P < 0.05, ** P < 0.01 (Kruskal–Wallis test followed by Steel test [compared with 3 rd lane]). Bars and error bars represent the mean ± SD. A schematic drawing of the relationships among ppMLC, LUZP1, and myosin phosphatase at tight junction (TJ)‐associated CRs to promote apical constriction. Source data are available online for this figure.

Article Snippet: GST‐ROCK1‐catalytic domain , Carna biosciences , Cat#01‐109.

Techniques: Binding Assay, Knock-Out, MANN-WHITNEY, Standard Deviation, Immunoprecipitation, Western Blot, In Vitro, Phosphorylation Assay

Box plots with dot density plots showing the ratio of the apical area/basal area in co‐cultures of Venus‐LUZP1‐expressing LUZP1 knockout (REV) and LUZP1 knockout (LUZP1 KO) Eph4 cells; 2 μM nocodazole treatment for 30 min partially reversed apical constriction of REV cells (REV, 0.65 ± 0.16 [control] vs. 0.90 ± 0.18 [nocodazole] vs. 0.64 ± 0.16 [washout]; KO, 1.30 ± 0.17 [control] vs. 1.07 ± 0.13 [nocodazole] vs. 1.32 ± 0.19 [washout]). ** P < 0.01 (Kruskal–Wallis test followed by Steel–Dwass test). The solid lines represent the medians, and the boxes represent the interquartile ranges. The error bars extending from the box represent the data within 1.5 times of the interquartile range. Representative confocal micrographs of co‐cultures of LUZP1‐expressing wild‐type (WT) and LUZP1 KO Eph4 cell treated with 2 μM nocodazole for 30 min. Nocodazole treatment partially reversed the difference in di‐phosphorylated MLC (ppMLC) levels within circumferential rings (CRs) between WT and LUZP1 KO cells. Scale bar, 10 μm. Bar plots with dot density plots showing that ppMLC levels within CRs were significantly downregulated in WT Eph4 cells after nocodazole treatment. Importantly, ppMLC levels in LUZP1 KO Eph4 cells were unchanged after nocodazole treatment (WT, 21.43 ± 6.96 arbitrary units [a.u.] [control] vs. 17.67 ± 5.40 a.u. [nocodazole] vs. 20.84 ± 7.19 a.u. [washout]; KO, 8.74 ± 1.71 a.u. [control] vs. 8.67 ± 1.89 a.u. [nocodazole] vs. 7.96 ± 2.35 a.u. [washout]). n = 3. ** P < 0.01 (Kruskal–Wallis test followed by Steel–Dwass test). Bars and error bars represent the mean ± standard deviation (SD). In vitro MLC phosphorylation assay using 1 μg MTs in addition to 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, 1 μg GST‐protein phosphatase 1c β/δ (PP1c β/δ), and 0–5 μg GST‐LUZP1. Quantification of the relative ppMLC/MLC ratio to the control showed that MTs promote LUZP1‐mediated inhibition of PP1c β/δ (1.00 [1 st ‐lane, control] vs. 1.42 ± 0.59 [2 nd ‐lane] vs. 1.72 ± 0.76 [3 rd ‐lane] vs. 1.99 ± 0.56 [4 th ‐lane] vs. 1.14 ± 0.37 [5 th ‐lane] vs. 2.87 ± 1.51 [6 th ‐lane] vs. 2.74 ± 1.19 [7 th ‐lane] vs. 2.50 ± 0.88 [8 th ‐lane]). n = 6. * P < 0.05 (Kruskal–Wallis test followed by Steel test [compared with 1 st lane]). Bars and error bars represent the mean ± SD. A schematic drawing of the relationships among MTs, ppMLC, LUZP1, and myosin phosphatase at TJ‐associated CRs to promote apical constriction. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: A microtubule‐LUZP1 association around tight junction promotes epithelial cell apical constriction

doi: 10.15252/embj.2020104712

Figure Lengend Snippet: Box plots with dot density plots showing the ratio of the apical area/basal area in co‐cultures of Venus‐LUZP1‐expressing LUZP1 knockout (REV) and LUZP1 knockout (LUZP1 KO) Eph4 cells; 2 μM nocodazole treatment for 30 min partially reversed apical constriction of REV cells (REV, 0.65 ± 0.16 [control] vs. 0.90 ± 0.18 [nocodazole] vs. 0.64 ± 0.16 [washout]; KO, 1.30 ± 0.17 [control] vs. 1.07 ± 0.13 [nocodazole] vs. 1.32 ± 0.19 [washout]). ** P < 0.01 (Kruskal–Wallis test followed by Steel–Dwass test). The solid lines represent the medians, and the boxes represent the interquartile ranges. The error bars extending from the box represent the data within 1.5 times of the interquartile range. Representative confocal micrographs of co‐cultures of LUZP1‐expressing wild‐type (WT) and LUZP1 KO Eph4 cell treated with 2 μM nocodazole for 30 min. Nocodazole treatment partially reversed the difference in di‐phosphorylated MLC (ppMLC) levels within circumferential rings (CRs) between WT and LUZP1 KO cells. Scale bar, 10 μm. Bar plots with dot density plots showing that ppMLC levels within CRs were significantly downregulated in WT Eph4 cells after nocodazole treatment. Importantly, ppMLC levels in LUZP1 KO Eph4 cells were unchanged after nocodazole treatment (WT, 21.43 ± 6.96 arbitrary units [a.u.] [control] vs. 17.67 ± 5.40 a.u. [nocodazole] vs. 20.84 ± 7.19 a.u. [washout]; KO, 8.74 ± 1.71 a.u. [control] vs. 8.67 ± 1.89 a.u. [nocodazole] vs. 7.96 ± 2.35 a.u. [washout]). n = 3. ** P < 0.01 (Kruskal–Wallis test followed by Steel–Dwass test). Bars and error bars represent the mean ± standard deviation (SD). In vitro MLC phosphorylation assay using 1 μg MTs in addition to 25 ng GST‐MLC, 4 ng GST‐ROCK1 catalytic domain, 1 mM ATP, 1 μg GST‐protein phosphatase 1c β/δ (PP1c β/δ), and 0–5 μg GST‐LUZP1. Quantification of the relative ppMLC/MLC ratio to the control showed that MTs promote LUZP1‐mediated inhibition of PP1c β/δ (1.00 [1 st ‐lane, control] vs. 1.42 ± 0.59 [2 nd ‐lane] vs. 1.72 ± 0.76 [3 rd ‐lane] vs. 1.99 ± 0.56 [4 th ‐lane] vs. 1.14 ± 0.37 [5 th ‐lane] vs. 2.87 ± 1.51 [6 th ‐lane] vs. 2.74 ± 1.19 [7 th ‐lane] vs. 2.50 ± 0.88 [8 th ‐lane]). n = 6. * P < 0.05 (Kruskal–Wallis test followed by Steel test [compared with 1 st lane]). Bars and error bars represent the mean ± SD. A schematic drawing of the relationships among MTs, ppMLC, LUZP1, and myosin phosphatase at TJ‐associated CRs to promote apical constriction. Source data are available online for this figure.

Article Snippet: GST‐ROCK1‐catalytic domain , Carna biosciences , Cat#01‐109.

Techniques: Expressing, Knock-Out, Standard Deviation, In Vitro, Phosphorylation Assay, Inhibition

Journal: The EMBO Journal

Article Title: A microtubule‐LUZP1 association around tight junction promotes epithelial cell apical constriction

doi: 10.15252/embj.2020104712

Figure Lengend Snippet:

Article Snippet: GST‐ROCK1‐catalytic domain , Carna biosciences , Cat#01‐109.

Techniques: Recombinant, Plasmid Preparation, Sequencing, Transfection, Protease Inhibitor, Purification, Western Blot, Blocking Assay, Software, Imaging, Modification

Figure 1. Effects of PAK4 overexpression and knockdown on mesenchymal transition in glioma cells. (a) Western blot analysis of 4910 and U251 glioma cells transfected with EV and PAK4-FL for 48 h along with untreated controls and GAPDH served as a loading control. (b) Representative micrographs of morphological characteristics in EV- or PAK4-FL-treated glioma cells after 48 h transfection. Scale bars: 10 μm. (c) Representative immunoblots from three independent experiments using whole cell lysates of glioma cells transfected with EV or PAK4-FL to assess changes in EMT markers. (d) Immunoblot analysis of effects of PAK4 downregulation using PAK4shRNA when compared with untreated and SV controls in 4910 and U251 cells. (e) Phase contrast micrographs of morphological characteristics of 4910 and U251 cells after SV and PAK4sh treatments for 48 h. Scale bars: 10 μm. (f) Confocal microscopy showing E-cadherin (green) and N-cadherin (red) expression in control, SV- and PAK4sh-treated cells. DAPI was used for nuclear counterstaining. Scale bars: 10 μm.

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 1. Effects of PAK4 overexpression and knockdown on mesenchymal transition in glioma cells. (a) Western blot analysis of 4910 and U251 glioma cells transfected with EV and PAK4-FL for 48 h along with untreated controls and GAPDH served as a loading control. (b) Representative micrographs of morphological characteristics in EV- or PAK4-FL-treated glioma cells after 48 h transfection. Scale bars: 10 μm. (c) Representative immunoblots from three independent experiments using whole cell lysates of glioma cells transfected with EV or PAK4-FL to assess changes in EMT markers. (d) Immunoblot analysis of effects of PAK4 downregulation using PAK4shRNA when compared with untreated and SV controls in 4910 and U251 cells. (e) Phase contrast micrographs of morphological characteristics of 4910 and U251 cells after SV and PAK4sh treatments for 48 h. Scale bars: 10 μm. (f) Confocal microscopy showing E-cadherin (green) and N-cadherin (red) expression in control, SV- and PAK4sh-treated cells. DAPI was used for nuclear counterstaining. Scale bars: 10 μm.

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Over Expression, Knockdown, Western Blot, Transfection, Control, Confocal Microscopy, Expressing

Figure 2. Radiation-induced nuclear localization of PAK4 and correlation with increased EMT in glioma cells. (a) PAK mRNA levels in control and IR (8 Gy)-treated cells as determined by quantitative PCR. Fold change values of PAK4 are represented as mean ± s.d. of levels obtained from at least five repetitions in three experimental replicates (*P ⩽0.01). (b) Western blotting with cellular lysates showing PAK4 and phospho- PAK4 expression in control and IR (8 Gy)-treated cells. (c) Western blot analysis of PAK4 and phospho-PAK4 levels in cytoplasmic and nuclear fractions with or without IR treatment. GAPDH and HDAC-1 were used as loading controls for cytoplasmic and nuclear fractions respectively. Relative expression levels of cytoplasmic and nuclear PAK4 were estimated by densitometry (ImageJ 1.42) and mean ± s.d. values were presented (*P ⩽0.01). (d) Immunocytochemical analysis to assess sub-cellular localization of PAK4 in control- and IR (8 Gy)-treated cells. Nuclei were counterstained with DAPI. (e) Micrographs showing morphological changes in 4910 and U251 cells after IR treatments. Scale bars: 10 μm. (f) Western blot analysis with whole-cell lysates to assess the expression of epithelial and mesenchymal regulator proteins. (g) Confocal microscopy to examine changes in N-cadherin (red) and E-cadherin (green) levels in IR-treated cells after 48 h. Nuclei were counterstained with DAPI. Scale bars: 10 μm. (h) Assessment of total cellular ROS content in control and IR-treated cells with H2DCFDA staining as described in Materials and methods section 48 h after IR treatment. Relative ROS levels from three independent experiments are shown as mean ± s.d. (*P ⩽0.01).

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 2. Radiation-induced nuclear localization of PAK4 and correlation with increased EMT in glioma cells. (a) PAK mRNA levels in control and IR (8 Gy)-treated cells as determined by quantitative PCR. Fold change values of PAK4 are represented as mean ± s.d. of levels obtained from at least five repetitions in three experimental replicates (*P ⩽0.01). (b) Western blotting with cellular lysates showing PAK4 and phospho- PAK4 expression in control and IR (8 Gy)-treated cells. (c) Western blot analysis of PAK4 and phospho-PAK4 levels in cytoplasmic and nuclear fractions with or without IR treatment. GAPDH and HDAC-1 were used as loading controls for cytoplasmic and nuclear fractions respectively. Relative expression levels of cytoplasmic and nuclear PAK4 were estimated by densitometry (ImageJ 1.42) and mean ± s.d. values were presented (*P ⩽0.01). (d) Immunocytochemical analysis to assess sub-cellular localization of PAK4 in control- and IR (8 Gy)-treated cells. Nuclei were counterstained with DAPI. (e) Micrographs showing morphological changes in 4910 and U251 cells after IR treatments. Scale bars: 10 μm. (f) Western blot analysis with whole-cell lysates to assess the expression of epithelial and mesenchymal regulator proteins. (g) Confocal microscopy to examine changes in N-cadherin (red) and E-cadherin (green) levels in IR-treated cells after 48 h. Nuclei were counterstained with DAPI. Scale bars: 10 μm. (h) Assessment of total cellular ROS content in control and IR-treated cells with H2DCFDA staining as described in Materials and methods section 48 h after IR treatment. Relative ROS levels from three independent experiments are shown as mean ± s.d. (*P ⩽0.01).

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Control, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Confocal Microscopy, Staining

Figure 3. Association of PAK4 with PPARγ in the nuclear compartment. (a) Identification of potential PAK4 associating TFs using TF–TF Interaction Array. PAK4 was immunoprecipitated from nuclear extracts of 4910 cells with anti-PAK4 antibody and used as a bait. Isotype- specific IgG precipitates were used as negative control. PAK4 association with various TFs is identified as horizontal duplicate spots on the x-ray film. ‘+’ indicates the positive control signals. (b) 4910 cells were treated with EV and PAK4-FL for 48 h and IP experiments was performed with nuclear lysates (500 μg) from 4910 cells with specific antibodies against PAK4 and non-specific IgG followed by immunoblotting with PPARγ. Inputs indicate 10% of each pre-IP samples. (c) PPARγ IP using anti-FLAG and anti-IgG antibody from nuclear lysates of 4910 cells at 48 h post transfection with EV or FLAG-PPARγ constructs followed by immunoblotting for PAK4. (d) IP experiments using 4910 lysates with either a PAK4 specific antibody or non-specific IgG followed by immunoprobing for PPARγ. Reciprocal IPs were performed with anti-PPARγ antibody and subsequent immunoblotting with PAK4 to confirm PAK4/PPARγ association in the nucleus. (e) Identification of minimal PPARγ- interaction domain of PAK4 using bacterially expressed GST, and GST-PPARγ purified using MagneGST Pull-Down System following manufacturer’s protocol. Biotin-labeled PAK4 truncated mutants (1–290aa, 291–591aa and 1–591aa) were incubated with GST-PPARγ, separated on 10% SDS–PAGE and detected as described in Materials and methods section (Top panel). Inputs (10% samples) were analyzed by SDS–PAGE (Bottom panel). (f) Schematic representation of mapping PPARγ interacting domain on PAK4 using different truncation mutants. CRIB: Cdc42-and Rac-interactive binding motif; GID: GEF-H1 Interaction Domain; KD: Kinase Domain. (g) EMSA was performed with 4910 Nuclear extracts (5 μg) to detect PPARγ activity. For the supershift analyses, specific antibodies against PAK4 and PPARγ were incubated with control sample before adding the biotin-labeled probe.

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 3. Association of PAK4 with PPARγ in the nuclear compartment. (a) Identification of potential PAK4 associating TFs using TF–TF Interaction Array. PAK4 was immunoprecipitated from nuclear extracts of 4910 cells with anti-PAK4 antibody and used as a bait. Isotype- specific IgG precipitates were used as negative control. PAK4 association with various TFs is identified as horizontal duplicate spots on the x-ray film. ‘+’ indicates the positive control signals. (b) 4910 cells were treated with EV and PAK4-FL for 48 h and IP experiments was performed with nuclear lysates (500 μg) from 4910 cells with specific antibodies against PAK4 and non-specific IgG followed by immunoblotting with PPARγ. Inputs indicate 10% of each pre-IP samples. (c) PPARγ IP using anti-FLAG and anti-IgG antibody from nuclear lysates of 4910 cells at 48 h post transfection with EV or FLAG-PPARγ constructs followed by immunoblotting for PAK4. (d) IP experiments using 4910 lysates with either a PAK4 specific antibody or non-specific IgG followed by immunoprobing for PPARγ. Reciprocal IPs were performed with anti-PPARγ antibody and subsequent immunoblotting with PAK4 to confirm PAK4/PPARγ association in the nucleus. (e) Identification of minimal PPARγ- interaction domain of PAK4 using bacterially expressed GST, and GST-PPARγ purified using MagneGST Pull-Down System following manufacturer’s protocol. Biotin-labeled PAK4 truncated mutants (1–290aa, 291–591aa and 1–591aa) were incubated with GST-PPARγ, separated on 10% SDS–PAGE and detected as described in Materials and methods section (Top panel). Inputs (10% samples) were analyzed by SDS–PAGE (Bottom panel). (f) Schematic representation of mapping PPARγ interacting domain on PAK4 using different truncation mutants. CRIB: Cdc42-and Rac-interactive binding motif; GID: GEF-H1 Interaction Domain; KD: Kinase Domain. (g) EMSA was performed with 4910 Nuclear extracts (5 μg) to detect PPARγ activity. For the supershift analyses, specific antibodies against PAK4 and PPARγ were incubated with control sample before adding the biotin-labeled probe.

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Immunoprecipitation, Negative Control, Positive Control, Western Blot, Transfection, Construct, Labeling, Incubation, SDS Page, Binding Assay, Activity Assay, Control

Figure 4. Radiation-enhanced PAK4/PPARγ binding in nucleus. (a) IP with antibodies against non-specific IgG and PPARγ using nuclear lysates prepared from control and IR (8 Gy)-treated 4910 and U251 cells followed by immunoprobing with PAK4 antibody (Top panels). Reciprocal IPs were performed with anti-IgG and anti-PAK4, and subsequently immunoprobed with PPARγ to confirm changes in radiation-induced PAK4/ PPARγ interaction in these cells (Bottom panels). Representative blots from three independent experiments are shown. (b) Sub-cellular localization analyses of PAK4 (green) and PPARγ (red) by confocal microscopy in control and IR-treated cells. Scale bars: 10 μm. (c) Protein-DNA array (version II) interaction analysis performed with immunoprecipitated PAK4 from 4910 nuclear extracts as described in Materials and methods section. PAK4 binding with TF consensus sequences was detected by duplicate spots on the membrane. ‘+’ indicates positive control signal.

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 4. Radiation-enhanced PAK4/PPARγ binding in nucleus. (a) IP with antibodies against non-specific IgG and PPARγ using nuclear lysates prepared from control and IR (8 Gy)-treated 4910 and U251 cells followed by immunoprobing with PAK4 antibody (Top panels). Reciprocal IPs were performed with anti-IgG and anti-PAK4, and subsequently immunoprobed with PPARγ to confirm changes in radiation-induced PAK4/ PPARγ interaction in these cells (Bottom panels). Representative blots from three independent experiments are shown. (b) Sub-cellular localization analyses of PAK4 (green) and PPARγ (red) by confocal microscopy in control and IR-treated cells. Scale bars: 10 μm. (c) Protein-DNA array (version II) interaction analysis performed with immunoprecipitated PAK4 from 4910 nuclear extracts as described in Materials and methods section. PAK4 binding with TF consensus sequences was detected by duplicate spots on the membrane. ‘+’ indicates positive control signal.

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Binding Assay, Control, Confocal Microscopy, DNA Array, Immunoprecipitation, Membrane, Positive Control

Figure 5. Radiation-induced PAK4/PPARγ recruitment on the PPARγ-binding site on Nox1 promoter. (a) Real-time PCR showing Nox1 transcriptional levels in control- and IR-treated cells. The fold change values are represented as mean ± s.d. (n = 5) obtained from at least three independent experiments (*P ⩽0.01). (b) Immunoblotting shows Nox1 expression with GAPDH served as an internal control. (c) Whole-cell lysates were subjected immunoblotting and representative blots from three independent experiments were shown. (d) Schematic representation of putative PPARγ binding sites on Nox1 promoter. Seven putative PPRE sites were identified located in the promoter (4 sites), exon-1 (1 site) and intron-1 (2 sites) of human Nox1 based on analysis of a 2.9-kb 5ʹ-flanking region of Nox1 (GenBank: ABC40742.1). ChIP primers specific for R-1, R-2, R-3 and R-4 regions (blue arrows) were used to determine PPARγ recruitment on Nox1 promoter. (e) ChIP analysis of PPARγ occupancy around PPREs on the Nox1 promoter using DNA from 4910 and U251 cells and IP with anti-IgG and anti-PPARγ antibodies with and without IR treatment. 5% of pre-ChIP DNA samples served as input controls for each sample. ChIP DNA from control and IR-treated cells were analyzed by quantitative PCR using ChIP-specific primers covering Nox1 promoter regions (R-1 to R-4). ChIP amplification is shown as percent input from three different experiments (n = 5; *P ⩽0.05, **P ⩽0.01). (f) ChIP assay was performed with R-2 primers and antibodies against non-specific IgG and PPARγ using ChIP DNA as described above in both 4910 and U251 cells. Subsequently, re-ChIP assay was performed using primary ChIP amplicons with anti-IgG and anti-PAK4 antibodies; results from three experimental replicates are shown.

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 5. Radiation-induced PAK4/PPARγ recruitment on the PPARγ-binding site on Nox1 promoter. (a) Real-time PCR showing Nox1 transcriptional levels in control- and IR-treated cells. The fold change values are represented as mean ± s.d. (n = 5) obtained from at least three independent experiments (*P ⩽0.01). (b) Immunoblotting shows Nox1 expression with GAPDH served as an internal control. (c) Whole-cell lysates were subjected immunoblotting and representative blots from three independent experiments were shown. (d) Schematic representation of putative PPARγ binding sites on Nox1 promoter. Seven putative PPRE sites were identified located in the promoter (4 sites), exon-1 (1 site) and intron-1 (2 sites) of human Nox1 based on analysis of a 2.9-kb 5ʹ-flanking region of Nox1 (GenBank: ABC40742.1). ChIP primers specific for R-1, R-2, R-3 and R-4 regions (blue arrows) were used to determine PPARγ recruitment on Nox1 promoter. (e) ChIP analysis of PPARγ occupancy around PPREs on the Nox1 promoter using DNA from 4910 and U251 cells and IP with anti-IgG and anti-PPARγ antibodies with and without IR treatment. 5% of pre-ChIP DNA samples served as input controls for each sample. ChIP DNA from control and IR-treated cells were analyzed by quantitative PCR using ChIP-specific primers covering Nox1 promoter regions (R-1 to R-4). ChIP amplification is shown as percent input from three different experiments (n = 5; *P ⩽0.05, **P ⩽0.01). (f) ChIP assay was performed with R-2 primers and antibodies against non-specific IgG and PPARγ using ChIP DNA as described above in both 4910 and U251 cells. Subsequently, re-ChIP assay was performed using primary ChIP amplicons with anti-IgG and anti-PAK4 antibodies; results from three experimental replicates are shown.

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Binding Assay, Real-time Polymerase Chain Reaction, Control, Western Blot, Expressing

Figure 6. Role of PAK4 in the regulation of PPARγ-mediated Nox1 and EMT in glioma cells. (a) Cells were subjected to SV and PAK4sh for 24 h and subsequently treated with IR for an additional 24 h. At the end of the treatments, whole-cell lysates were subjected to western blotting with GAPDH as internal loading control. (b) Cells were treated with EV and PPARγ-FL for 24 h followed by treatment with PAK4sh for an additional 24 h. Western blotting was performed with whole cell lysates; representative blots from three independent experiments are shown. (c) 4910 cells were treated independently with SV-control or PAK4sh or GW9662 (10 μM) or IR (8 Gy) or with combinations of SV+IR, PAK4sh+IR and GW9662+IR for 48 h. Total ROS levels were estimated as described in Materials and methods section and are presented as mean ± s.d. from three experimental replicates (*P ⩽0.01).

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 6. Role of PAK4 in the regulation of PPARγ-mediated Nox1 and EMT in glioma cells. (a) Cells were subjected to SV and PAK4sh for 24 h and subsequently treated with IR for an additional 24 h. At the end of the treatments, whole-cell lysates were subjected to western blotting with GAPDH as internal loading control. (b) Cells were treated with EV and PPARγ-FL for 24 h followed by treatment with PAK4sh for an additional 24 h. Western blotting was performed with whole cell lysates; representative blots from three independent experiments are shown. (c) 4910 cells were treated independently with SV-control or PAK4sh or GW9662 (10 μM) or IR (8 Gy) or with combinations of SV+IR, PAK4sh+IR and GW9662+IR for 48 h. Total ROS levels were estimated as described in Materials and methods section and are presented as mean ± s.d. from three experimental replicates (*P ⩽0.01).

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Western Blot, Control

Figure 7. Effect of PAK4 downregulation on orthotopic tumor growth in nude mice. (a) Paraffin-embedded brain tumor sections were stained and tumor volumes were measured as described in Materials and methods section. Relative tumor size is shown as mean ± s.d. obtained from different groups as indicated (n = 6; *P ⩽0.05, **P ⩽0.01). (b) Immunohistochemical analysis of brain tumors from nude mice that were intracranially implanted with SV or PAK4sh cells and subjected to IR treatments as described in Materials and methods section; representative micrographs are shown. Inset: staining with Non-specific IgG. (c) Confocal microscopy was performed in tumor sections to determine N-cadherin (red) and E-cadherin expression (green) levels. (d) Schematic diagram represents the radiation-induced PAK4 nuclear translocation, binding with PPARγ and co-recruitment of PAK4/PPARγ complex on to Nox1 promoter, which further results in Nox1 transactivation, ROS generation and EMT induction in glioma cells.

Journal: Oncogene

Article Title: A novel interaction of PAK4 with PPARγ to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma.

doi: 10.1038/onc.2016.261

Figure Lengend Snippet: Figure 7. Effect of PAK4 downregulation on orthotopic tumor growth in nude mice. (a) Paraffin-embedded brain tumor sections were stained and tumor volumes were measured as described in Materials and methods section. Relative tumor size is shown as mean ± s.d. obtained from different groups as indicated (n = 6; *P ⩽0.05, **P ⩽0.01). (b) Immunohistochemical analysis of brain tumors from nude mice that were intracranially implanted with SV or PAK4sh cells and subjected to IR treatments as described in Materials and methods section; representative micrographs are shown. Inset: staining with Non-specific IgG. (c) Confocal microscopy was performed in tumor sections to determine N-cadherin (red) and E-cadherin expression (green) levels. (d) Schematic diagram represents the radiation-induced PAK4 nuclear translocation, binding with PPARγ and co-recruitment of PAK4/PPARγ complex on to Nox1 promoter, which further results in Nox1 transactivation, ROS generation and EMT induction in glioma cells.

Article Snippet: The human PAK4.shRNA plasmid (PAK4sh) comprising a pool of three different targeting shRNAs (sc-39060-SH) and specific scrambled shRNA vector (SV) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), full-length GFP-tagged PAK4 overexpression plasmid (PAK4-FL) (Origene, Rockville, MD, USA), kinase-dead PAK4 plasmid (PAK4K350M),64 PAK4 NLS mutant plasmid (NLS1, Lysine mutated to Alanine within 4–8 aa; PAK4-NLS-Mut), GST-tagged PPARγ (GST-PPARγ; Addgene plasmid 16549),65 FLAG-tagged PPARγ (FLAG-PPARγ; Addgene plasmid 8895)66 and respective empty vector controls were used in the study.

Techniques: Staining, Immunohistochemical staining, Confocal Microscopy, Expressing, Translocation Assay, Binding Assay

Primer sequences used for a quantitative real-time polymerase chain reaction.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: Primer sequences used for a quantitative real-time polymerase chain reaction.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Sequencing

Immunohistochemical expression of PAK4 and PD-L1 in human osteosarcoma tissue and survival analysis. ( a ) Immunohistochemical expression of PAK4 and PD-L1 in human osteosarcoma tissue. Original magnification, ×400. ( b ) Statistical analysis to determine cut-off points. In receiver operating characteristic curve analysis, the cut-off point for both the immunohistochemical staining scores of PAK4 expression (red arrowhead) and PD-L1 expression (blue arrow) was twelve. ( c ) Kaplan–Meier survival analysis according to PAK4 and PD-L1 expression for overall survival and relapse-free survival in 32 osteosarcoma patients. ( d ) Kaplan–Meier survival analysis for overall survival and relapse-free survival according to PAK4 and PD-L1 expression in 23 osteosarcoma patients who received postoperative chemotherapy.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: Immunohistochemical expression of PAK4 and PD-L1 in human osteosarcoma tissue and survival analysis. ( a ) Immunohistochemical expression of PAK4 and PD-L1 in human osteosarcoma tissue. Original magnification, ×400. ( b ) Statistical analysis to determine cut-off points. In receiver operating characteristic curve analysis, the cut-off point for both the immunohistochemical staining scores of PAK4 expression (red arrowhead) and PD-L1 expression (blue arrow) was twelve. ( c ) Kaplan–Meier survival analysis according to PAK4 and PD-L1 expression for overall survival and relapse-free survival in 32 osteosarcoma patients. ( d ) Kaplan–Meier survival analysis for overall survival and relapse-free survival according to PAK4 and PD-L1 expression in 23 osteosarcoma patients who received postoperative chemotherapy.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Immunohistochemical staining, Expressing, Staining

Association between clinicopathologic variables and the expression of  PAK4  and PD-L1 in 32 osteosarcomas.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: Association between clinicopathologic variables and the expression of PAK4 and PD-L1 in 32 osteosarcomas.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Expressing

Univariate survival analysis in 32 osteosarcomas.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: Univariate survival analysis in 32 osteosarcomas.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques:

Multivariate survival analysis in 32 osteosarcomas.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: Multivariate survival analysis in 32 osteosarcomas.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques:

The effects of PAK4 expression on proliferation and invasiveness in osteosarcoma cells. ( a , b ) MTT proliferation assays ( a ) and colony-forming assay ( b ) after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. Colony-forming assays were performed after knockdown or overexpression of PAK4 in osteosarcoma cells. U2OS (3 × 10 3 ) and KHOS/NP (3 × 10 3 ) cells were seeded in culture plates for seven days. Western blot for PAK4 and GAPDH was performed to show knockdown and overexpression of PAK4 in osteosarcoma cells. ( c , d ) Migration ( c ) and invasion ( d ) assay after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. The migration assay was performed by seeding 5 × 10 4 U2OS and 5 × 10 4 KHOS/NP cells in the upper chamber for 48 h. The invasion assay was performed by seeding 1 × 10 5 U2OS and 1 × 10 5 KHOS/NP cells in the upper chamber for 48 h. ( e ) Western blotting for PAK4, FOXO3, phosphorylated FOXO3 (pFOXO3), cyclin D1, P27, BAX, BCL2, snail, TGF-β1, MMP2, and MMP9 after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells 24 h after transfection. ( f ) Quantitative reverse-transcription polymerase chain reaction for PAK4, FOXO3, cyclin D1, P27, BAX, BCL2, snail, TGF-β1, MMP2, and MMP9 after knockdown or overexpression of PAK4 in osteosarcoma cells. ( g ) Gross and histologic findings of resected tumors grown in BALB/c nude mice by implanting 1 × 10 6 KHOS/NP cells that were transfected with empty vectors, shRNA for PAK4 , or plasmid for wild-type PAK4 into the marrow space of the right proximal tibia. The tumor volume was measured every seven days with the length × width × height × 0.52 mm 3 equation. The mice were euthanized six weeks after tumor implantation. Resected tumors were H&E stained. ( h ) Gross and histologic findings of pulmonary metastatic nodules in BALB/c nude mice. Arrows indicate metastatic nodules. * p < 0.05; ** p < 0.001; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shControl, control vector for shRNA; shPAK4, vector for shRNA for PAK4 .

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: The effects of PAK4 expression on proliferation and invasiveness in osteosarcoma cells. ( a , b ) MTT proliferation assays ( a ) and colony-forming assay ( b ) after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. Colony-forming assays were performed after knockdown or overexpression of PAK4 in osteosarcoma cells. U2OS (3 × 10 3 ) and KHOS/NP (3 × 10 3 ) cells were seeded in culture plates for seven days. Western blot for PAK4 and GAPDH was performed to show knockdown and overexpression of PAK4 in osteosarcoma cells. ( c , d ) Migration ( c ) and invasion ( d ) assay after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. The migration assay was performed by seeding 5 × 10 4 U2OS and 5 × 10 4 KHOS/NP cells in the upper chamber for 48 h. The invasion assay was performed by seeding 1 × 10 5 U2OS and 1 × 10 5 KHOS/NP cells in the upper chamber for 48 h. ( e ) Western blotting for PAK4, FOXO3, phosphorylated FOXO3 (pFOXO3), cyclin D1, P27, BAX, BCL2, snail, TGF-β1, MMP2, and MMP9 after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells 24 h after transfection. ( f ) Quantitative reverse-transcription polymerase chain reaction for PAK4, FOXO3, cyclin D1, P27, BAX, BCL2, snail, TGF-β1, MMP2, and MMP9 after knockdown or overexpression of PAK4 in osteosarcoma cells. ( g ) Gross and histologic findings of resected tumors grown in BALB/c nude mice by implanting 1 × 10 6 KHOS/NP cells that were transfected with empty vectors, shRNA for PAK4 , or plasmid for wild-type PAK4 into the marrow space of the right proximal tibia. The tumor volume was measured every seven days with the length × width × height × 0.52 mm 3 equation. The mice were euthanized six weeks after tumor implantation. Resected tumors were H&E stained. ( h ) Gross and histologic findings of pulmonary metastatic nodules in BALB/c nude mice. Arrows indicate metastatic nodules. * p < 0.05; ** p < 0.001; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shControl, control vector for shRNA; shPAK4, vector for shRNA for PAK4 .

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Expressing, Knockdown, Over Expression, Western Blot, Migration, Invasion Assay, Transfection, Reverse Transcription, Polymerase Chain Reaction, shRNA, Plasmid Preparation, Tumor Implantation, Staining, Control

The effects of PAK4 expression on proliferation and apoptosis of osteosarcoma cells under treatment of doxorubicin. ( a , b ) MTT proliferation assays ( a ) and colony-forming assay ( b ) after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells treated with 0.1 µM doxorubicin. In colony-forming assay, U2OS (3 × 10 3 ) and KHOS/NP (3 × 10 3 ) cells were seeded in culture plates for one week. ( c , d ) Western blotting ( c ) and Annexin V flowcytometric analysis for apoptosis ( d ) after knockdown or overexpression of PAK4 in osteosarcoma cells under treatment with 0.1 µM doxorubicin. Doxorubicin was applied to osteosarcoma cells 24 h after transfection. * p < 0.05; ** p < 0.001; ns , not significant; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shPAK4, vector for shRNA for PAK4 ; DOX, doxorubicin.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: The effects of PAK4 expression on proliferation and apoptosis of osteosarcoma cells under treatment of doxorubicin. ( a , b ) MTT proliferation assays ( a ) and colony-forming assay ( b ) after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells treated with 0.1 µM doxorubicin. In colony-forming assay, U2OS (3 × 10 3 ) and KHOS/NP (3 × 10 3 ) cells were seeded in culture plates for one week. ( c , d ) Western blotting ( c ) and Annexin V flowcytometric analysis for apoptosis ( d ) after knockdown or overexpression of PAK4 in osteosarcoma cells under treatment with 0.1 µM doxorubicin. Doxorubicin was applied to osteosarcoma cells 24 h after transfection. * p < 0.05; ** p < 0.001; ns , not significant; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shPAK4, vector for shRNA for PAK4 ; DOX, doxorubicin.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Expressing, Knockdown, Over Expression, Western Blot, Transfection, Plasmid Preparation, shRNA

PAK4 is involved in the stabilization of PD-L1 protein in osteosarcoma cells. ( a ) Western blot for PAK4 and PD-L1 after knockdown or overexpression of PAK4 in osteosarcoma cells. ( b ) Western blot for PAK4 and PD-L1 in osteosarcoma cells after treatment with PAK4 inhibitor KPT9274 (1 µM for 48 h). ( c ) Quantitative reverse-transcription polymerase chain reaction for PAK4 and PD-L1 after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. ( d ) Immunofluorescence staining of U2OS and KHOS/NP osteosarcoma cells after knockdown or overexpression of PAK4 . The cells were incubated with primary antibodies for PAK4 and PD-L1. Thereafter, the slides were incubated with Alexa Fluor 488 anti-mouse IgG (green) or Alexa Fluor 594 anti-rabbit IgG (red) and counterstained with 4′,6-diamidino-2-phenylindole (DAPI, blue). Images were taken with a Zeiss LSM 880 with Airyscan confocal microscope. ( e ) U2OS and KHOS/NP osteosarcoma cell lysates were immunoprecipitated with PAK4 or PD-L1 and immunoblotted with PAK4 and PD-L1. ( f ) U2OS cells were transfected with control vector or shRNA for PAK4 and treated with 30 µmol/L cycloheximide or 30 µmol/L MG132 for 0.5 to 2.0 h. Thereafter, protein lysates were immunoblotted with PD-L1 and GAPDH. ( g ) Total protein lysate from U2OS cells transfected with empty vector or shRNA for PAK4 and treated with 30 µmol/L MG132 for two hours was immunoprecipitated with PD-L1 and immunoblotted with anti-ubiquitin antibodies. ** p < 0.001; ns , not significant; CHX, cycloheximide; EV, empty vector; EVs, empty vectors; IP, immunoprecipitation; PAK4-OE, vector for wild-type PAK4 ; shControl, control vector for shRNA; shPAK4, vector for shRNA for PAK4 ; WB, western blot.

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: PAK4 is involved in the stabilization of PD-L1 protein in osteosarcoma cells. ( a ) Western blot for PAK4 and PD-L1 after knockdown or overexpression of PAK4 in osteosarcoma cells. ( b ) Western blot for PAK4 and PD-L1 in osteosarcoma cells after treatment with PAK4 inhibitor KPT9274 (1 µM for 48 h). ( c ) Quantitative reverse-transcription polymerase chain reaction for PAK4 and PD-L1 after knockdown or overexpression of PAK4 in U2OS and KHOS/NP osteosarcoma cells. ( d ) Immunofluorescence staining of U2OS and KHOS/NP osteosarcoma cells after knockdown or overexpression of PAK4 . The cells were incubated with primary antibodies for PAK4 and PD-L1. Thereafter, the slides were incubated with Alexa Fluor 488 anti-mouse IgG (green) or Alexa Fluor 594 anti-rabbit IgG (red) and counterstained with 4′,6-diamidino-2-phenylindole (DAPI, blue). Images were taken with a Zeiss LSM 880 with Airyscan confocal microscope. ( e ) U2OS and KHOS/NP osteosarcoma cell lysates were immunoprecipitated with PAK4 or PD-L1 and immunoblotted with PAK4 and PD-L1. ( f ) U2OS cells were transfected with control vector or shRNA for PAK4 and treated with 30 µmol/L cycloheximide or 30 µmol/L MG132 for 0.5 to 2.0 h. Thereafter, protein lysates were immunoblotted with PD-L1 and GAPDH. ( g ) Total protein lysate from U2OS cells transfected with empty vector or shRNA for PAK4 and treated with 30 µmol/L MG132 for two hours was immunoprecipitated with PD-L1 and immunoblotted with anti-ubiquitin antibodies. ** p < 0.001; ns , not significant; CHX, cycloheximide; EV, empty vector; EVs, empty vectors; IP, immunoprecipitation; PAK4-OE, vector for wild-type PAK4 ; shControl, control vector for shRNA; shPAK4, vector for shRNA for PAK4 ; WB, western blot.

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: Western Blot, Knockdown, Over Expression, Reverse Transcription, Polymerase Chain Reaction, Immunofluorescence, Staining, Incubation, Microscopy, Immunoprecipitation, Transfection, Control, Plasmid Preparation, shRNA, Ubiquitin Proteomics

In vivo growth of KHOS/NP osteosarcoma cells in BALB/c nude mice and infiltrations of immune cells in C57BL/6J mice. ( a ) HOS/NP osteosarcoma cells (2.5 × 10 6 ) transfected with empty vectors, vector for shRNA for PAK4 , or vector for wild-type PAK4 were implanted subcutaneously in the back of BALB/c nude mice and grown for six weeks. Donor tumor blocks sized 2 mm × 2 mm × 2 mm from the resected tumor of BALB/c nude mice were subcutaneously implanted in the backs of C57BL/6J mice. The figure was created with BioRender.com ( https://www.biorender.com (accessed on 10 January 2024)). ( b ) Tumor growth in BALB/c nude mice. ( c ) The growth of tumor block in the back of C57BL/6J mice. Tumor volumes were calculated as “length × width × height × 0.52”. ( d ) Histologic findings and immunofluorescence staining for PAK4 (green) and PD-L1 (red) in the resected tumor grown in C57BL/6J mice. ( e ) Immunofluorescence staining and quantification for FOXP3, PD1, CD4, CD8, and CD4/CD8 ratio. Tumor cubes (0.5 mm × 0.5 mm × 0.5 mm) derived from the KHOS/NP tumor cells grown subcutaneously in BALB/c nude mice were implanted subcutaneously in C57BL/6J mice. Four days after the implantation of tumor cubes, the tumors were resected and evaluated with immunofluorescence staining for FOXP3 (green), PD1 (red), CD4 (green), and CD8 (red). The number of positively stained cells was counted in three high-power fields in each case, and the sum of the numbers was used for evaluation. The area of one high-power field image was 0.0144 mm 2 . Therefore, 0.0432 mm 2 was evaluated in each case. * p < 0.05; ** p < 0.001; ns , not significant; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shPAK4, vector for shRNA for PAK4 .

Journal: Cells

Article Title: PAK4 Is Involved in the Stabilization of PD-L1 and the Resistance to Doxorubicin in Osteosarcoma and Predicts the Survival of Diagnosed Patients

doi: 10.3390/cells13171444

Figure Lengend Snippet: In vivo growth of KHOS/NP osteosarcoma cells in BALB/c nude mice and infiltrations of immune cells in C57BL/6J mice. ( a ) HOS/NP osteosarcoma cells (2.5 × 10 6 ) transfected with empty vectors, vector for shRNA for PAK4 , or vector for wild-type PAK4 were implanted subcutaneously in the back of BALB/c nude mice and grown for six weeks. Donor tumor blocks sized 2 mm × 2 mm × 2 mm from the resected tumor of BALB/c nude mice were subcutaneously implanted in the backs of C57BL/6J mice. The figure was created with BioRender.com ( https://www.biorender.com (accessed on 10 January 2024)). ( b ) Tumor growth in BALB/c nude mice. ( c ) The growth of tumor block in the back of C57BL/6J mice. Tumor volumes were calculated as “length × width × height × 0.52”. ( d ) Histologic findings and immunofluorescence staining for PAK4 (green) and PD-L1 (red) in the resected tumor grown in C57BL/6J mice. ( e ) Immunofluorescence staining and quantification for FOXP3, PD1, CD4, CD8, and CD4/CD8 ratio. Tumor cubes (0.5 mm × 0.5 mm × 0.5 mm) derived from the KHOS/NP tumor cells grown subcutaneously in BALB/c nude mice were implanted subcutaneously in C57BL/6J mice. Four days after the implantation of tumor cubes, the tumors were resected and evaluated with immunofluorescence staining for FOXP3 (green), PD1 (red), CD4 (green), and CD8 (red). The number of positively stained cells was counted in three high-power fields in each case, and the sum of the numbers was used for evaluation. The area of one high-power field image was 0.0144 mm 2 . Therefore, 0.0432 mm 2 was evaluated in each case. * p < 0.05; ** p < 0.001; ns , not significant; EVs, empty vectors; PAK4-OE, vector for wild-type PAK4 ; shPAK4, vector for shRNA for PAK4 .

Article Snippet: The following primary antibodies were used in this study: PAK4 (#sc-390507, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PD-L1 (#13684, Cell Signaling Technology, Beverly, MA, USA), cleaved PARP1 (#5625, Cell Signaling Technology, Beverly, MA, USA), cleaved caspase 3 (#9661, Cell Signaling Technology, Beverly, MA, USA), cyclin D1 (#2922, Cell Signaling Technology, Beverly, MA, USA), P27 (#sc-528, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BCL2 (#sc-509, Santa Cruz Biotechnology, Santa Cruz, CA, USA), BAX (#sc-20076, Santa Cruz Biotechnology, Santa Cruz, CA, USA), snail (#sc-271977, Santa Cruz Biotechnology, Santa Cruz, CA, USA/#ab180714, Abcam, Cambridge, UK), transforming growth factor β1 (TGF-β1) (#3709, Cell Signaling Technology, Beverly, MA, USA), MMP2 (#sc-13595, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MMP9 (#sc-21733, Santa Cruz Biotechnology, Santa Cruz, CA, USA), FOXO3 (#2880, Cell Signaling Technology, Beverly, MA, USA), phosphorylated FOXO3 (#9464, Cell Signaling Technology, Beverly, MA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#2118, Cell Signaling Technology, Beverly, MA, USA).

Techniques: In Vivo, Transfection, Plasmid Preparation, shRNA, Blocking Assay, Immunofluorescence, Staining, Derivative Assay

Fig. 1 – Morphology of wild-type (+/+) and Pak4 homozygous mutant (/) embryos. (A) The Pak4/ embryo is developmentally retarded and smaller than its Pak4+/+ littermate (E10.5). (B) Analysis of cell proliferation (a) and apoptosis (b) in E9.5 Pak4+/+ and Pak4/ embryos. (a) Immunostaining with Ki67 antibody (brown) shows high level of proliferation throughout the Pak4+/+ embryo, and the highest level in the neural tissue indicated by arrows; whereas dramatically decreased proliferation was observed in Pak4-null embryos at this stage. Lower panel shows higher magnification of the boxed areas in upper panel. (b) Apoptosis detected by cleaved caspase-3 level (brown) was increased in Pak4/ embryo, especially in the neural tissue indicated by arrowheads, compared to Pak4+/+ embryo. Lower panel shows higher magnification of the boxed areas in upper panel. (C) Extraembryonic tissues of Pak4+/+ and Pak4/ embryos at E10.5. Note that the vitelline vessels visible in the Pak4+/+ yolk sac are missing in the Pak4/ yolk sac and that the Pak4/ placenta contains less blood and looks paler than the Pak4+/+ placenta. (D) Pak4 expression in extraembryonic tissues. FP, fetal placenta; MP, maternal placenta; YS, yolk sac; WT, wild-type mouse embryonic fibroblast (MEF) control; KO, Pak4/ MEF control.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 1 – Morphology of wild-type (+/+) and Pak4 homozygous mutant (/) embryos. (A) The Pak4/ embryo is developmentally retarded and smaller than its Pak4+/+ littermate (E10.5). (B) Analysis of cell proliferation (a) and apoptosis (b) in E9.5 Pak4+/+ and Pak4/ embryos. (a) Immunostaining with Ki67 antibody (brown) shows high level of proliferation throughout the Pak4+/+ embryo, and the highest level in the neural tissue indicated by arrows; whereas dramatically decreased proliferation was observed in Pak4-null embryos at this stage. Lower panel shows higher magnification of the boxed areas in upper panel. (b) Apoptosis detected by cleaved caspase-3 level (brown) was increased in Pak4/ embryo, especially in the neural tissue indicated by arrowheads, compared to Pak4+/+ embryo. Lower panel shows higher magnification of the boxed areas in upper panel. (C) Extraembryonic tissues of Pak4+/+ and Pak4/ embryos at E10.5. Note that the vitelline vessels visible in the Pak4+/+ yolk sac are missing in the Pak4/ yolk sac and that the Pak4/ placenta contains less blood and looks paler than the Pak4+/+ placenta. (D) Pak4 expression in extraembryonic tissues. FP, fetal placenta; MP, maternal placenta; YS, yolk sac; WT, wild-type mouse embryonic fibroblast (MEF) control; KO, Pak4/ MEF control.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Mutagenesis, Immunostaining, Expressing, Control

Fig. 2 – Vasculature in Pak4+/+ and Pak4/ yolk sacs at E10.5. Whole-mount staining with hematoxylin (A) and anti-Cd31 antibody (B) show poor vascular development in the Pak4/ yolk sac compared with the Pak4+/+ yolk sac. (C) Yolk sac sections stained with hematoxylin/eosin. Left panel: low magnification; right panel: high magnification. Note that the vessels in the Pak4/ yolk sac are abnormally dilated and contain fewer blood cells compared to +/+ yolk sac.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 2 – Vasculature in Pak4+/+ and Pak4/ yolk sacs at E10.5. Whole-mount staining with hematoxylin (A) and anti-Cd31 antibody (B) show poor vascular development in the Pak4/ yolk sac compared with the Pak4+/+ yolk sac. (C) Yolk sac sections stained with hematoxylin/eosin. Left panel: low magnification; right panel: high magnification. Note that the vessels in the Pak4/ yolk sac are abnormally dilated and contain fewer blood cells compared to +/+ yolk sac.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Staining

Fig. 3 – Hematoxylin/eosin stained radial sections of E10.5 Pak4+/+ and Pak4/ placentas. (Upper panel) Low magnification. Note that the labyrinth layer (La) of the Pak4/ placenta is severely reduced in size and disorganized compared to the well- developed Pak4+/+ placenta. The dashed lines mark the boundaries between the labyrinth and the spongiotrophoblast layer. Al, allantois; Ch, chorionic plate; Sp, spongiotrophoblast; Gi, giant cell zone. (Lower panel) Higher magnification of the boxed areas in (upper panel), to show the architecture of labyrinth layer. Note in the Pak4+/+ labyrinth layer, the extensive intermingling of the fetal (arrowheads, identified by dark-colored large nucleated RBCs) and the maternal (arrows, identified by small enucleated RBCs) blood vessels. In contrast, in Pak4/ placenta, fetal blood vessels fail to penetrate into the chorionic plate to form the labyrinth layer.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 3 – Hematoxylin/eosin stained radial sections of E10.5 Pak4+/+ and Pak4/ placentas. (Upper panel) Low magnification. Note that the labyrinth layer (La) of the Pak4/ placenta is severely reduced in size and disorganized compared to the well- developed Pak4+/+ placenta. The dashed lines mark the boundaries between the labyrinth and the spongiotrophoblast layer. Al, allantois; Ch, chorionic plate; Sp, spongiotrophoblast; Gi, giant cell zone. (Lower panel) Higher magnification of the boxed areas in (upper panel), to show the architecture of labyrinth layer. Note in the Pak4+/+ labyrinth layer, the extensive intermingling of the fetal (arrowheads, identified by dark-colored large nucleated RBCs) and the maternal (arrows, identified by small enucleated RBCs) blood vessels. In contrast, in Pak4/ placenta, fetal blood vessels fail to penetrate into the chorionic plate to form the labyrinth layer.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Staining

Fig. 4 – Expression of trophoblast differentiation specific markers in the Pak4/ placenta at E10.5. (Upper panel) The giant cell marker mPL-1 is expressed in both Pak4+/+ and Pak4/ placentas, as assessed by in situ hybridization. (Lower panel) Expression of the spongiotrophoblast maker 4311 is present in both genotypes.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 4 – Expression of trophoblast differentiation specific markers in the Pak4/ placenta at E10.5. (Upper panel) The giant cell marker mPL-1 is expressed in both Pak4+/+ and Pak4/ placentas, as assessed by in situ hybridization. (Lower panel) Expression of the spongiotrophoblast maker 4311 is present in both genotypes.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Expressing, Marker, In Situ Hybridization

Fig. 5 – Epiblast-restricted ablation of Pak4 cannot rescue embryonic lethality. (A) Diagram of floxed Pak4 vector and targeting strategy for the generation of conditional Pak4 knockout mice. LoxP sites (L) are indicated by triangles. (B) Growth retardation in the Sox2Cre;Pak4D/f embryo at E10.5 compared to its normal littermate. (C) Vascular defect in the Sox2Cre;Pak4D/f yolk sac.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 5 – Epiblast-restricted ablation of Pak4 cannot rescue embryonic lethality. (A) Diagram of floxed Pak4 vector and targeting strategy for the generation of conditional Pak4 knockout mice. LoxP sites (L) are indicated by triangles. (B) Growth retardation in the Sox2Cre;Pak4D/f embryo at E10.5 compared to its normal littermate. (C) Vascular defect in the Sox2Cre;Pak4D/f yolk sac.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Plasmid Preparation, Knock-Out

Fig. 6 – Epiblast-restricted deletion of Pak4 fails to redress the placental defect. The underdeveloped labyrinth layer persists in Sox2Cre;Pak4D/f placenta compared to normal placenta. The dashed lines mark the boundaries between the labyrinth and the spongiotrophoblast layer.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 6 – Epiblast-restricted deletion of Pak4 fails to redress the placental defect. The underdeveloped labyrinth layer persists in Sox2Cre;Pak4D/f placenta compared to normal placenta. The dashed lines mark the boundaries between the labyrinth and the spongiotrophoblast layer.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques:

Fig. 7 – Defective vasculature in Pak4-null embryo. (A and B) Whole-mount immunostaining of E9.5 Pak4+/+ and Pak4/ embryos with anti-Cd31 antibody. (A) Note that the Pak4/ embryo shows dramatically weaker staining than the Pak4+/+ embryo (upper panel). Middle and lower panels show the details in the head and the intersomitic regions (boxed areas in upper panel), respectively. Pak4+/+ embryo shows well-branched networks of small vessels (arrows) in both regions. These are not seen in Pak4/ embryo. (B) Sagittal sections of Cd31 whole-mount immunostained embryos showing the vasculature inside the embryos. Compared to Pak4+/+ embryos, strikingly reduced staining throughout the Pak4/ embryos were observed. Arrows indicate the staining of vessels. (C) The expression of Pak4 in normal human vascular endothelial cells were detected by Western blot analysis. WT, wild-type MEF control; KO, Pak4/ MEF control; A, aorta; PA, pulmonary artery; UA, umbilical artery; UV, umbilical vein.

Journal: Mechanisms of development

Article Title: Essential role for the Pak4 protein kinase in extraembryonic tissue development and vessel formation.

doi: 10.1016/j.mod.2009.05.002

Figure Lengend Snippet: Fig. 7 – Defective vasculature in Pak4-null embryo. (A and B) Whole-mount immunostaining of E9.5 Pak4+/+ and Pak4/ embryos with anti-Cd31 antibody. (A) Note that the Pak4/ embryo shows dramatically weaker staining than the Pak4+/+ embryo (upper panel). Middle and lower panels show the details in the head and the intersomitic regions (boxed areas in upper panel), respectively. Pak4+/+ embryo shows well-branched networks of small vessels (arrows) in both regions. These are not seen in Pak4/ embryo. (B) Sagittal sections of Cd31 whole-mount immunostained embryos showing the vasculature inside the embryos. Compared to Pak4+/+ embryos, strikingly reduced staining throughout the Pak4/ embryos were observed. Arrows indicate the staining of vessels. (C) The expression of Pak4 in normal human vascular endothelial cells were detected by Western blot analysis. WT, wild-type MEF control; KO, Pak4/ MEF control; A, aorta; PA, pulmonary artery; UA, umbilical artery; UV, umbilical vein.

Article Snippet: Western blot analysis was performed using polyclonal Pak4 antibody from Cell Signaling.

Techniques: Immunostaining, Staining, Expressing, Western Blot, Control

(A) Baseline miR-199a-3p levels in levels in human esophageal cell lines and human samples. (A, a) Endogenous relative miR-199a-3p expression levels in human esophageal cell lines as examined by q-PCR. MiR-199a-3p levels of human esophageal cancer cell lines (TE7, TE10 and FLO-1) were compared to miR-199a-3p levels of human esophageal epithelial cells (hESO). Total RNA was isolated from cells, followed by RT-q-PCR. Levels of miR-199a-3p were normalized with small nuclear RNA U6. A representative experiment of three independent experiments is shown. Error bars represents ± S.D. and statistical significance based on a two-tailed Student’s t test is indicated by * (p < 0.001). (A, b) Copy numbers of miR-199a-3p in esophageal cell lines shown in (A, a). (A, c) Copy numbers of miR-199a-3p in human esophageal cancer samples and matched benign esophageal epithelium. The copy numbers were measured using droplet digital PCR (dd PCR) technique and the concentration of miR was calculated in copies per microliter in each cell line and human specimen. (B) Levels of PAK4 are inversely correlated with miR-199a-3p levels. (B, a) Relative PAK4 mRNA levels in human esophageal cancer cell lines compared to hESO cells as examined by q-PCR. Levels of PAK4 mRNA for each cell line are normalized with GAPDH mRNA levels. Statistical significance is indicated by * (p < 0.001). (B, b) Copy numbers of PAK4 mRNA in esophageal cell lines shown in (B, a) measured by dd-PCR. (B, c) Copy numbers of PAK4 mRNA in human esophageal cancer samples and matched benign esophageal epithelium measured by dd-PCR. (B, d) Representative immunoblot forendogenous PAK4 protein levels in human esophageal cell lines shown in (B, a) GAPDH was used as a loading control. S.I. = Relative PAK4 protein mean signal intensity. Signal intensity of the target proteins is determined by densitometry and is normalized by signal intensity of GAPDH. Relative signal intensity (SI) for target protein is calculated compare to hESO.

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: (A) Baseline miR-199a-3p levels in levels in human esophageal cell lines and human samples. (A, a) Endogenous relative miR-199a-3p expression levels in human esophageal cell lines as examined by q-PCR. MiR-199a-3p levels of human esophageal cancer cell lines (TE7, TE10 and FLO-1) were compared to miR-199a-3p levels of human esophageal epithelial cells (hESO). Total RNA was isolated from cells, followed by RT-q-PCR. Levels of miR-199a-3p were normalized with small nuclear RNA U6. A representative experiment of three independent experiments is shown. Error bars represents ± S.D. and statistical significance based on a two-tailed Student’s t test is indicated by * (p < 0.001). (A, b) Copy numbers of miR-199a-3p in esophageal cell lines shown in (A, a). (A, c) Copy numbers of miR-199a-3p in human esophageal cancer samples and matched benign esophageal epithelium. The copy numbers were measured using droplet digital PCR (dd PCR) technique and the concentration of miR was calculated in copies per microliter in each cell line and human specimen. (B) Levels of PAK4 are inversely correlated with miR-199a-3p levels. (B, a) Relative PAK4 mRNA levels in human esophageal cancer cell lines compared to hESO cells as examined by q-PCR. Levels of PAK4 mRNA for each cell line are normalized with GAPDH mRNA levels. Statistical significance is indicated by * (p < 0.001). (B, b) Copy numbers of PAK4 mRNA in esophageal cell lines shown in (B, a) measured by dd-PCR. (B, c) Copy numbers of PAK4 mRNA in human esophageal cancer samples and matched benign esophageal epithelium measured by dd-PCR. (B, d) Representative immunoblot forendogenous PAK4 protein levels in human esophageal cell lines shown in (B, a) GAPDH was used as a loading control. S.I. = Relative PAK4 protein mean signal intensity. Signal intensity of the target proteins is determined by densitometry and is normalized by signal intensity of GAPDH. Relative signal intensity (SI) for target protein is calculated compare to hESO.

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Expressing, Isolation, Two Tailed Test, Digital PCR, Concentration Assay, Western Blot

(A) Cells were transfected with control miR or (A, a) with 50 nM pre-miR-199a-3p (TE7 TE10 and FLO-1) or (A, c) with 50 nM anti-miR-199a-3p (hESO). Forty-eight hours post-transfection, levels of miR-199a-3p (A, a and c) and U6 (A, b and d) RNA were measured by q-PCR. Values are mean ± SD from three independent sets of experiment in triplicate. Statistical significance is indicated by * (p < 0.002). (B) In similar experiments, whole cell lysates were subjected to Western blot analysis for PAK4 protein levels in (B, a) TE7, (B, b) TE10 and (B, c) FLO-1 cells, following control miR or 50 nM pre-miR-199a-3p overexpression. (C) Western blot analysis of PAK4 expression in hESO cells following transfection with control miR or 50 nM anti-miR-199a-3p. Representative immunoblots of three independent experiments in all the cell lines. Relative signal intensity was calculated as explained in Figure .

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: (A) Cells were transfected with control miR or (A, a) with 50 nM pre-miR-199a-3p (TE7 TE10 and FLO-1) or (A, c) with 50 nM anti-miR-199a-3p (hESO). Forty-eight hours post-transfection, levels of miR-199a-3p (A, a and c) and U6 (A, b and d) RNA were measured by q-PCR. Values are mean ± SD from three independent sets of experiment in triplicate. Statistical significance is indicated by * (p < 0.002). (B) In similar experiments, whole cell lysates were subjected to Western blot analysis for PAK4 protein levels in (B, a) TE7, (B, b) TE10 and (B, c) FLO-1 cells, following control miR or 50 nM pre-miR-199a-3p overexpression. (C) Western blot analysis of PAK4 expression in hESO cells following transfection with control miR or 50 nM anti-miR-199a-3p. Representative immunoblots of three independent experiments in all the cell lines. Relative signal intensity was calculated as explained in Figure .

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Transfection, Western Blot, Over Expression, Expressing

(A) Cells were transfected with control miR or (A, a) with 50 nM pre-miR-199a-3p (TE7, TE10 & FLO-1) or (A, b) with 50 nM anti-miR-199a-3p (hESO). Forty-eight hours post-transfection, levels of miR-199a-3p and U6 RNAwere measured by q-PCR. Values are mean ± SD from three independent sets of experiments performed in triplicate. Statistical significance is indicated by * (p < 0.001). (B) Stability of PAK4 mRNA. Following transfection of either control miR or 50 nM pre-miR-199a-3p in TE7 cells (B, a) or 50 nM anti-miR-199a-3p (hESO) (B, b), total RNA was isolated at indicated time points after administration of actinomycin D (4μM). The remaining levels of PAK4 mRNA were measured by q-PCR. PAK4 mRNA levels were normalized with GAPDH. The half-life was calculated from the first order equation t 1/2 = ln2/k. Each point is the mean ± S.D. of three separate experiments.

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: (A) Cells were transfected with control miR or (A, a) with 50 nM pre-miR-199a-3p (TE7, TE10 & FLO-1) or (A, b) with 50 nM anti-miR-199a-3p (hESO). Forty-eight hours post-transfection, levels of miR-199a-3p and U6 RNAwere measured by q-PCR. Values are mean ± SD from three independent sets of experiments performed in triplicate. Statistical significance is indicated by * (p < 0.001). (B) Stability of PAK4 mRNA. Following transfection of either control miR or 50 nM pre-miR-199a-3p in TE7 cells (B, a) or 50 nM anti-miR-199a-3p (hESO) (B, b), total RNA was isolated at indicated time points after administration of actinomycin D (4μM). The remaining levels of PAK4 mRNA were measured by q-PCR. PAK4 mRNA levels were normalized with GAPDH. The half-life was calculated from the first order equation t 1/2 = ln2/k. Each point is the mean ± S.D. of three separate experiments.

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Transfection, Isolation

(A) Schematic diagram of PAK4 mRNA. (BS) indicates predicted binding sites for miR-199a-3p. (B) Levels of (B, a) miR-199a-3p and (b) U6 RNA following transfection of biotinylated-miR-199a-3p (5′ACAGUAGUCUGCACAUUGGUUA 3′Bi, 50 nM) or control biotin-labelled scrambled miR for 48 hrs in the TE7 cells, as measured by q-PCR analysis. Mean ± S.D. of three independent experiments performed in triplicate is shown, and statistical significance is indicated by * (p<0.001). (C) MiR-199a-3p binds to PAK4 mRNA. (C, a) Levels of PAK4 and MAP3K11 mRNAs in the material pulled down by biotinylated-miR-199a-3p and control miR. (C, b) Respective total input mRNA measured by q-PCR. The miR enrichment was calculated as follows: miR-199a-3p pull-down/control-miR pull-down (A), miR-199a-3p input/control-miR input (B), Fold binding = A/B. Representative bar diagram from three separate set of experiments. Each set of experiments was performed in triplicate. Error bars represent mean ±S.D. and * indicates statistical significance (p < 0.002). (C, c) Copy numbers of PAK4 and Map3K11 mRNAs in the pull-down material mention in (C, a). The levels were measured using dd-PCR. (D, a) Levels of PAK4 and MAP3K11 mRNAs in the material pulled down by biotin-labelled mutated miR-199a-3p (5′ CAGACGCCUGCACAUUGGUU A 3′ Bi, 50 nM) and control miR. (D, b) Respective total input mRNA measured by q-PCR. (E, a) Schematic representation for PAK4 luciferase reporter constructs containing either the full length 3’UTR (FL-3’UTR) or individual predicted miR-199a-3p binding sites (BS1 or BS2). (E, b) Luciferase activity in the PAK4 reporter constructs following co-transfection with pre-miR-199a-3p (50nM) or control miR in TE7 cells for 36 hours. Luciferase activity in cells transfected with control miR was considered as 100%. Firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the mean of three independent experiments, where all the experiments were carried out in triplicate. Error bars represent mean ± S.D. and * represents statistically significant (p < 0.05), based on two-tailed Student’s t test. (F, a) The binding sequence of the miR-199a-3p potential binding sites in (PAK4-full length 3’UTR construct (schematic FL-WT) was mutated either in binding site 1 (schematic, MT-BS1) or in binding site 2 (schematic, MT-BS2) or in both the binding sites (schematic MT-both BS) by substituting 4 bases (underlined). (F, b) Luciferase activity was measured in each construct following co-transfection with pre-miR-199a-3p (50nM) or control miR in TE7 cells for 36 hours. Luciferase activity in cells transfected with control miR was considered as 100%.

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: (A) Schematic diagram of PAK4 mRNA. (BS) indicates predicted binding sites for miR-199a-3p. (B) Levels of (B, a) miR-199a-3p and (b) U6 RNA following transfection of biotinylated-miR-199a-3p (5′ACAGUAGUCUGCACAUUGGUUA 3′Bi, 50 nM) or control biotin-labelled scrambled miR for 48 hrs in the TE7 cells, as measured by q-PCR analysis. Mean ± S.D. of three independent experiments performed in triplicate is shown, and statistical significance is indicated by * (p<0.001). (C) MiR-199a-3p binds to PAK4 mRNA. (C, a) Levels of PAK4 and MAP3K11 mRNAs in the material pulled down by biotinylated-miR-199a-3p and control miR. (C, b) Respective total input mRNA measured by q-PCR. The miR enrichment was calculated as follows: miR-199a-3p pull-down/control-miR pull-down (A), miR-199a-3p input/control-miR input (B), Fold binding = A/B. Representative bar diagram from three separate set of experiments. Each set of experiments was performed in triplicate. Error bars represent mean ±S.D. and * indicates statistical significance (p < 0.002). (C, c) Copy numbers of PAK4 and Map3K11 mRNAs in the pull-down material mention in (C, a). The levels were measured using dd-PCR. (D, a) Levels of PAK4 and MAP3K11 mRNAs in the material pulled down by biotin-labelled mutated miR-199a-3p (5′ CAGACGCCUGCACAUUGGUU A 3′ Bi, 50 nM) and control miR. (D, b) Respective total input mRNA measured by q-PCR. (E, a) Schematic representation for PAK4 luciferase reporter constructs containing either the full length 3’UTR (FL-3’UTR) or individual predicted miR-199a-3p binding sites (BS1 or BS2). (E, b) Luciferase activity in the PAK4 reporter constructs following co-transfection with pre-miR-199a-3p (50nM) or control miR in TE7 cells for 36 hours. Luciferase activity in cells transfected with control miR was considered as 100%. Firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the mean of three independent experiments, where all the experiments were carried out in triplicate. Error bars represent mean ± S.D. and * represents statistically significant (p < 0.05), based on two-tailed Student’s t test. (F, a) The binding sequence of the miR-199a-3p potential binding sites in (PAK4-full length 3’UTR construct (schematic FL-WT) was mutated either in binding site 1 (schematic, MT-BS1) or in binding site 2 (schematic, MT-BS2) or in both the binding sites (schematic MT-both BS) by substituting 4 bases (underlined). (F, b) Luciferase activity was measured in each construct following co-transfection with pre-miR-199a-3p (50nM) or control miR in TE7 cells for 36 hours. Luciferase activity in cells transfected with control miR was considered as 100%.

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Binding Assay, Transfection, Luciferase, Construct, Activity Assay, Cotransfection, Two Tailed Test, Sequencing

(A) Changes in CD1 promoter activity after co-transfection of CD1-promoter (100 ng, 1748 CD1 promoter PGL3 basic, # 32726) luciferase reporter construct, pRL-TkRenilla (10 ng, Promega) with either control miR, (A, a) pre-miR-199a-3p (50nM) or (A, c) anti-miR-199a-3p (50nM). Firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the mean of three independent experiments, where all the experiments were carried out in triplicate. Luciferase activity in cells transfected with control miR is considered 100%. Error bars represent mean ± S.D. and * represents statistical significance (p < 0.0001). (A, b and d) The corresponding PAK4 protein levels in whole cell lysates derived from the cells used for the CD1 promoter activity assay shown in (A, a and c) respectively. (B) TE7 cells were transfected with control scrambled siRNA or (B, a) PAK4-siRNA-1, (B, b) PAK4-siRNA-2, (B, c) PAK4 CRISPR/Cas9 KO plasmid. The total cell extract was made after 48 hrs and subjected to Western blot analysis for PAK4 and CD1. Beta Tubulin was used as a loading control. Signal intensity was determined as described in Figure . (C) Changes in levels of PAK4 and CD1 mRNAs post-transfection of control, scrambled siRNA or (C, a) PAK4 siRNA-1, (C, b) PAK4 CRISPR/Cas9KO plasmid. Total RNA was isolated and levels of PAK4, CD1 and GAPDH were determined by q-PCR. mRNA levels for cells transfected with control scrambled siRNA were set as 100%. Statistical significance calculated by t test and represented by * p<0.001. (D) Changes in CD1 promoter activity in PAK4 silenced TE7 cells using PAK4 siRNA-1 or PAK4 CRISPR/Cas9KO plasmid. Promoter activity was measured as described in (A) Luciferase activity for cells transfected with control, scrambled siRNA was set as 100%. * indicates statistical significance p<0.0001. (E) PAK4 rescues CD1 levels. (E, a) Following overexpression of pre-miR-199a-3p (50nM) in TE7 cells (middle & last lane) cells were transfected with 3μg PAK4 plasmid (last lane). Levels of PAK4 (top panel) and CD1 (middle panel) were measured by Western blot. Levels of target proteins were normalized by Beta Tubulin (bottom panel). SI indicates relative signal intensity of PAK4 and CD1. Relative signal intensity is determined as explained in Figure . (E, b) Changes in CD1 promoter activity in the TE7 cells after co-transfection of CD1 promoter with PAK4 plasmid and/or pre-miR-199a-3p as described in (E, a). Mean ± S.D. of three independent experiments performed in triplicate is shown. Statistical significance is indicated by * (p<0.0001).

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: (A) Changes in CD1 promoter activity after co-transfection of CD1-promoter (100 ng, 1748 CD1 promoter PGL3 basic, # 32726) luciferase reporter construct, pRL-TkRenilla (10 ng, Promega) with either control miR, (A, a) pre-miR-199a-3p (50nM) or (A, c) anti-miR-199a-3p (50nM). Firefly luciferase activity was normalized to Renilla luciferase activity and expressed as the mean of three independent experiments, where all the experiments were carried out in triplicate. Luciferase activity in cells transfected with control miR is considered 100%. Error bars represent mean ± S.D. and * represents statistical significance (p < 0.0001). (A, b and d) The corresponding PAK4 protein levels in whole cell lysates derived from the cells used for the CD1 promoter activity assay shown in (A, a and c) respectively. (B) TE7 cells were transfected with control scrambled siRNA or (B, a) PAK4-siRNA-1, (B, b) PAK4-siRNA-2, (B, c) PAK4 CRISPR/Cas9 KO plasmid. The total cell extract was made after 48 hrs and subjected to Western blot analysis for PAK4 and CD1. Beta Tubulin was used as a loading control. Signal intensity was determined as described in Figure . (C) Changes in levels of PAK4 and CD1 mRNAs post-transfection of control, scrambled siRNA or (C, a) PAK4 siRNA-1, (C, b) PAK4 CRISPR/Cas9KO plasmid. Total RNA was isolated and levels of PAK4, CD1 and GAPDH were determined by q-PCR. mRNA levels for cells transfected with control scrambled siRNA were set as 100%. Statistical significance calculated by t test and represented by * p<0.001. (D) Changes in CD1 promoter activity in PAK4 silenced TE7 cells using PAK4 siRNA-1 or PAK4 CRISPR/Cas9KO plasmid. Promoter activity was measured as described in (A) Luciferase activity for cells transfected with control, scrambled siRNA was set as 100%. * indicates statistical significance p<0.0001. (E) PAK4 rescues CD1 levels. (E, a) Following overexpression of pre-miR-199a-3p (50nM) in TE7 cells (middle & last lane) cells were transfected with 3μg PAK4 plasmid (last lane). Levels of PAK4 (top panel) and CD1 (middle panel) were measured by Western blot. Levels of target proteins were normalized by Beta Tubulin (bottom panel). SI indicates relative signal intensity of PAK4 and CD1. Relative signal intensity is determined as explained in Figure . (E, b) Changes in CD1 promoter activity in the TE7 cells after co-transfection of CD1 promoter with PAK4 plasmid and/or pre-miR-199a-3p as described in (E, a). Mean ± S.D. of three independent experiments performed in triplicate is shown. Statistical significance is indicated by * (p<0.0001).

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Activity Assay, Cotransfection, Luciferase, Construct, Transfection, Derivative Assay, CRISPR, Plasmid Preparation, Western Blot, Isolation, Over Expression

Primer sequences used to generate luciferase reporter constructs for miR-199a-3p binding studies

Journal: Oncotarget

Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4

doi: 10.18632/oncotarget.25375

Figure Lengend Snippet: Primer sequences used to generate luciferase reporter constructs for miR-199a-3p binding studies

Article Snippet: In overexpression experiments, 3μg PAK4 plasmid (OriGene, Rockville, MD, USA) was utilized.

Techniques: Luciferase, Construct, Binding Assay, Sequencing

( a ) TG693 and TG003 chemical structures. ( b ) Pharmacokinetic profile of TG693 after a single 30 mg kg −1 dose administered by subcutaneous injection in imprinting control region (ICR) mice. Data indicate the mean ± SEM (n = 3). ( c ) Recombinant CLK1 was incubated with the substrate peptide in the presence of the indicated concentrations of small molecules. Data represent the means ± SD (n = 3). Representative dose-response curves with Hill slopes are shown. ( d ) TG693 competitive ATP inhibition is shown in Michaelis-Menten (left) and Hanes-Woolf (right) plots. CLK1 kinase activity was measured at the indicated concentrations of TG693 and ATP. Velocity was plotted versus [ATP] and [ATP]/velocity was plotted versus [ATP]. ( e ) Map of the inhibitory activities of TG693 on a kinase dendrogram. Percent inhibition by 1 μM TG693 was measured for a panel of 313 kinases. Red circles indicate the inhibited kinases and are sized according to percent inhibition. The illustration was reproduced courtesy of Cell Signaling Technology, Inc. ( www.cellsignal.com ).

Journal: Scientific Reports

Article Title: Development of an orally available inhibitor of CLK1 for skipping a mutated dystrophin exon in Duchenne muscular dystrophy

doi: 10.1038/srep46126

Figure Lengend Snippet: ( a ) TG693 and TG003 chemical structures. ( b ) Pharmacokinetic profile of TG693 after a single 30 mg kg −1 dose administered by subcutaneous injection in imprinting control region (ICR) mice. Data indicate the mean ± SEM (n = 3). ( c ) Recombinant CLK1 was incubated with the substrate peptide in the presence of the indicated concentrations of small molecules. Data represent the means ± SD (n = 3). Representative dose-response curves with Hill slopes are shown. ( d ) TG693 competitive ATP inhibition is shown in Michaelis-Menten (left) and Hanes-Woolf (right) plots. CLK1 kinase activity was measured at the indicated concentrations of TG693 and ATP. Velocity was plotted versus [ATP] and [ATP]/velocity was plotted versus [ATP]. ( e ) Map of the inhibitory activities of TG693 on a kinase dendrogram. Percent inhibition by 1 μM TG693 was measured for a panel of 313 kinases. Red circles indicate the inhibited kinases and are sized according to percent inhibition. The illustration was reproduced courtesy of Cell Signaling Technology, Inc. ( www.cellsignal.com ).

Article Snippet: The reaction mixture containing serially diluted inhibitors, 10 mM MOPS-KOH (pH 6.5), 10 mM magnesium chloride, 200 μM EDTA, 1 μM ATP, 0.167 μCi of [γ- 32 P] ATP, 0.417 μg of synthetic RS peptide, and recombinant GST-tagged human CLK1 (Cat #04–126, Carna Biosciences, Kobe, Japan) was prepared in a final volume of 25 μL.

Techniques: Injection, Recombinant, Incubation, Inhibition, Activity Assay

( a ) SR protein phosphorylation was assessed in HeLa cells treated with TG693 and TG003 for 1 h. Lamin B served as a loading control. Uncropped images have been provided in . ( b , c ) Effect of TG693 on exon 31 skipping with the reporter plasmid. Transfected HeLa cells were incubated in the presence of TG693, TG003, or DMSO vehicle for 24 h. Reporter and endogenous CLK1 splicing was then analyzed by RT-PCR. GAPDH served as a control. The Splicing ratios were quantified by intensity analysis and normalized to GAPDH expression. Uncropped images have been provided in and , respectively. Data represent the means ± SD (n = 3).

Journal: Scientific Reports

Article Title: Development of an orally available inhibitor of CLK1 for skipping a mutated dystrophin exon in Duchenne muscular dystrophy

doi: 10.1038/srep46126

Figure Lengend Snippet: ( a ) SR protein phosphorylation was assessed in HeLa cells treated with TG693 and TG003 for 1 h. Lamin B served as a loading control. Uncropped images have been provided in . ( b , c ) Effect of TG693 on exon 31 skipping with the reporter plasmid. Transfected HeLa cells were incubated in the presence of TG693, TG003, or DMSO vehicle for 24 h. Reporter and endogenous CLK1 splicing was then analyzed by RT-PCR. GAPDH served as a control. The Splicing ratios were quantified by intensity analysis and normalized to GAPDH expression. Uncropped images have been provided in and , respectively. Data represent the means ± SD (n = 3).

Article Snippet: The reaction mixture containing serially diluted inhibitors, 10 mM MOPS-KOH (pH 6.5), 10 mM magnesium chloride, 200 μM EDTA, 1 μM ATP, 0.167 μCi of [γ- 32 P] ATP, 0.417 μg of synthetic RS peptide, and recombinant GST-tagged human CLK1 (Cat #04–126, Carna Biosciences, Kobe, Japan) was prepared in a final volume of 25 μL.

Techniques: Plasmid Preparation, Transfection, Incubation, Reverse Transcription Polymerase Chain Reaction, Expressing

( a ) TG693 bioavailability in the tibialis anterior (TA) muscle of ICR mice after oral administration of a single 30 mg kg −1 dose. Data represent the mean ± SEM (n = 3). ( b ) SR protein phosphorylation status in the TA muscle of ICR mice after oral administration. Lamin B served as a loading control. SRSF4 phosphorylation was quantified by densitometry. Uncropped images are provided in . Data represent means ± SD (n = 5). * p < 0.05. ( c,d ) Clk1 expression in the TA muscle, heart and diaphragm were analyzed by RT-PCR with a GAPDH internal control. Uncropped images are provided in and in , respectively. Data represent the means ± SD (n = 3). * p < 0.05.

Journal: Scientific Reports

Article Title: Development of an orally available inhibitor of CLK1 for skipping a mutated dystrophin exon in Duchenne muscular dystrophy

doi: 10.1038/srep46126

Figure Lengend Snippet: ( a ) TG693 bioavailability in the tibialis anterior (TA) muscle of ICR mice after oral administration of a single 30 mg kg −1 dose. Data represent the mean ± SEM (n = 3). ( b ) SR protein phosphorylation status in the TA muscle of ICR mice after oral administration. Lamin B served as a loading control. SRSF4 phosphorylation was quantified by densitometry. Uncropped images are provided in . Data represent means ± SD (n = 5). * p < 0.05. ( c,d ) Clk1 expression in the TA muscle, heart and diaphragm were analyzed by RT-PCR with a GAPDH internal control. Uncropped images are provided in and in , respectively. Data represent the means ± SD (n = 3). * p < 0.05.

Article Snippet: The reaction mixture containing serially diluted inhibitors, 10 mM MOPS-KOH (pH 6.5), 10 mM magnesium chloride, 200 μM EDTA, 1 μM ATP, 0.167 μCi of [γ- 32 P] ATP, 0.417 μg of synthetic RS peptide, and recombinant GST-tagged human CLK1 (Cat #04–126, Carna Biosciences, Kobe, Japan) was prepared in a final volume of 25 μL.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

ECs isolated from three human GBM tumors (patients 5377, 5391 and 5465) were transduced to express CRISPR sgRNA targeting PAK4 or a random sequence. Stable sgRNA-expressing ECs were harvested by flow cytometry sorting. a–g, RNA was extracted and subjected to transcriptome analysis by RNA-seq. a, Expression of PAK genes. Top, immunoblot analysis. Bottom, RNA-seq analysis, with quantificaton below (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). FPKM, fragments per kilobase of transcript per million mapped reads. b, t-distributed stochastic neighbor embedding (t-SNE) analysis of all of the mapped genes. c, Global change profiles in RNA expression. d, Heat map for genes with altered expression (change > 50%), as determined by RNA-seq. e, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. f, RNA was isolated and analyzed by quantitative RT-PCR. The results were normalized to GAPDH expression (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. mRNA, messenger RNA. g, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. h, Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results.

Journal: Nature cancer

Article Title: Targeting PAK4 to reprogram the vascular microenvironment and improve CAR-T immunotherapy for glioblastoma

doi: 10.1038/s43018-020-00147-8

Figure Lengend Snippet: ECs isolated from three human GBM tumors (patients 5377, 5391 and 5465) were transduced to express CRISPR sgRNA targeting PAK4 or a random sequence. Stable sgRNA-expressing ECs were harvested by flow cytometry sorting. a–g, RNA was extracted and subjected to transcriptome analysis by RNA-seq. a, Expression of PAK genes. Top, immunoblot analysis. Bottom, RNA-seq analysis, with quantificaton below (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). FPKM, fragments per kilobase of transcript per million mapped reads. b, t-distributed stochastic neighbor embedding (t-SNE) analysis of all of the mapped genes. c, Global change profiles in RNA expression. d, Heat map for genes with altered expression (change > 50%), as determined by RNA-seq. e, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. f, RNA was isolated and analyzed by quantitative RT-PCR. The results were normalized to GAPDH expression (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. mRNA, messenger RNA. g, Expression of mesenchymal genes, as determined by RNA-seq. The numbers indicate the average changes in gene expression by PAK4 knockdown. h, Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results.

Article Snippet: ECs were transfected with non-targeting control siRNA (Qiagen (1027280) or Thermo Fisher Scientific (AM4611)) or with siRNAs targeting Snail (Thermo Fisher Scientific; s13185), Slug (Thermo Fisher Scientific; s13127), ZEB1 (Thermo Fisher Scientific; s229971 or 4392420), MEF2D (Dharmacon; L-009884-00-0005), LEF1 (Dharmacon; L-015396-00-0005), PPAR-γ (Dharmacon; L-003436-00-0005) or PAK4 (Thermo Fisher Scientific; s20134 or 4390824) using RNAiMAX Lipofectamine (Invitrogen; 13778075) in serum-free Opti-MEM medium (Gibco; 31985-070) for 12 h, followed by incubation with serum-supplemented medium for 24 h. The guide RNA sequence (5′-GTGTTTGGGAAGAGGAAGAAG-3′) targeting PAK4 was subcloned into lentiCRISPRv2 puro vector (Addgene; 52961).

Techniques: Isolation, CRISPR, Sequencing, Expressing, Flow Cytometry, RNA Sequencing, Western Blot, Derivative Assay, RNA Expression, Gene Expression, Knockdown, Quantitative RT-PCR

a, ECs were isolated from three human GBM tumors (patients 5377, 5391 and 5465), followed by transduction to express CRISPR sgRNA targeting PAK4 or a random sequence. RNA was extracted and subjected to transcriptome analysis by RNA-seq. Genes associated with tight and adherens junctions were analyzed. Left, heat map. Right, quantitative results (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). b, Human ECs isolated from normal brain or GBM tumors were transduced with lentivirus that expresses CRISPR sgRNA targeting PAK4 or a random sequence. Cell lysates were immunoblotted. Exp, exposure. c, Human GBM-derived ECs were transfected with an siRNA targeting ZEB1 or a random sequence, followed by immunoblot analysis. d, GBM ECs were transfected with an siRNA targeting SLUG or a random sequence. Cell lysates were immunoblotted. The experiments in b–d were repeated independently twice with similar results. e, Nuclei extracts from human normal brain ECs or GBM ECs were immunoprecipitated with an anti-ZEB1 antibody or a control antibody, followed by ChIP analysis of ZEB1 binding to the claudin-14 promoter (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. Ab, antibody. The numerical values at the top indicate the distance from transcription start site (TSS). f, Human GBM-derived ECs were transfected with an siRNA targeting PAK4, ZEB1 or a random sequence. The cells were seeded on transwells and subjected to monolayer permeability analysis (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by one-way ANOVA. g, Human GBM-derived ECs were transfected with an siRNA targeting PAK4, SLUG or ZEB1, followed by incubation with PKH-labeled human T cells and imaging. Left, representative images. Scale bar, 50 μm. Right, quantified results (n = 4 T cell samples, each derived from a distinct human donor; means ± s.e.m.). Statistical significance was determined by one-way ANOVA.

Journal: Nature cancer

Article Title: Targeting PAK4 to reprogram the vascular microenvironment and improve CAR-T immunotherapy for glioblastoma

doi: 10.1038/s43018-020-00147-8

Figure Lengend Snippet: a, ECs were isolated from three human GBM tumors (patients 5377, 5391 and 5465), followed by transduction to express CRISPR sgRNA targeting PAK4 or a random sequence. RNA was extracted and subjected to transcriptome analysis by RNA-seq. Genes associated with tight and adherens junctions were analyzed. Left, heat map. Right, quantitative results (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). b, Human ECs isolated from normal brain or GBM tumors were transduced with lentivirus that expresses CRISPR sgRNA targeting PAK4 or a random sequence. Cell lysates were immunoblotted. Exp, exposure. c, Human GBM-derived ECs were transfected with an siRNA targeting ZEB1 or a random sequence, followed by immunoblot analysis. d, GBM ECs were transfected with an siRNA targeting SLUG or a random sequence. Cell lysates were immunoblotted. The experiments in b–d were repeated independently twice with similar results. e, Nuclei extracts from human normal brain ECs or GBM ECs were immunoprecipitated with an anti-ZEB1 antibody or a control antibody, followed by ChIP analysis of ZEB1 binding to the claudin-14 promoter (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. Ab, antibody. The numerical values at the top indicate the distance from transcription start site (TSS). f, Human GBM-derived ECs were transfected with an siRNA targeting PAK4, ZEB1 or a random sequence. The cells were seeded on transwells and subjected to monolayer permeability analysis (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by one-way ANOVA. g, Human GBM-derived ECs were transfected with an siRNA targeting PAK4, SLUG or ZEB1, followed by incubation with PKH-labeled human T cells and imaging. Left, representative images. Scale bar, 50 μm. Right, quantified results (n = 4 T cell samples, each derived from a distinct human donor; means ± s.e.m.). Statistical significance was determined by one-way ANOVA.

Article Snippet: ECs were transfected with non-targeting control siRNA (Qiagen (1027280) or Thermo Fisher Scientific (AM4611)) or with siRNAs targeting Snail (Thermo Fisher Scientific; s13185), Slug (Thermo Fisher Scientific; s13127), ZEB1 (Thermo Fisher Scientific; s229971 or 4392420), MEF2D (Dharmacon; L-009884-00-0005), LEF1 (Dharmacon; L-015396-00-0005), PPAR-γ (Dharmacon; L-003436-00-0005) or PAK4 (Thermo Fisher Scientific; s20134 or 4390824) using RNAiMAX Lipofectamine (Invitrogen; 13778075) in serum-free Opti-MEM medium (Gibco; 31985-070) for 12 h, followed by incubation with serum-supplemented medium for 24 h. The guide RNA sequence (5′-GTGTTTGGGAAGAGGAAGAAG-3′) targeting PAK4 was subcloned into lentiCRISPRv2 puro vector (Addgene; 52961).

Techniques: Isolation, Transduction, CRISPR, Sequencing, RNA Sequencing, Derivative Assay, Transfection, Western Blot, Immunoprecipitation, Control, Binding Assay, Permeability, Incubation, Labeling, Imaging

a, Human GBM ECs (n = 3 EC samples, each derived from a distinct human GBM tumor) with or without PAK4 sgRNA treatment were analyzed by RNA-seq. The promoter sequences of downregulated genes were analyzed against the MSigDB database and the most common motifs were identified. The corresponding transcription factors (TFs) are shown. b, Nuclei extracts from normal brain ECs or GBM ECs were analyzed using a multiplex transcription factor activity assay. c, Human GBM ECs were transfected with an siRNA targeting MEF2, LEF1, PPARγ or a random sequence. Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results. d, Human GBM ECs were transfected with siRNA targeting PAK4 or a random sequence. Nuclei extracts were immunoprecipitated using an anti-MEF2 antibody or a control antibody, followed by ChIP analysis of MEF2 binding to the ZEB1 promoter (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. e, Human GBM-derived ECs were transfected with an siRNA that targets PAK4 or a random sequence. Nuclei extracts were analyzed for MEF2 transcriptional activity (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-tailed Student’s t-test.

Journal: Nature cancer

Article Title: Targeting PAK4 to reprogram the vascular microenvironment and improve CAR-T immunotherapy for glioblastoma

doi: 10.1038/s43018-020-00147-8

Figure Lengend Snippet: a, Human GBM ECs (n = 3 EC samples, each derived from a distinct human GBM tumor) with or without PAK4 sgRNA treatment were analyzed by RNA-seq. The promoter sequences of downregulated genes were analyzed against the MSigDB database and the most common motifs were identified. The corresponding transcription factors (TFs) are shown. b, Nuclei extracts from normal brain ECs or GBM ECs were analyzed using a multiplex transcription factor activity assay. c, Human GBM ECs were transfected with an siRNA targeting MEF2, LEF1, PPARγ or a random sequence. Cell lysates were immunoblotted. This experiment was repeated independently twice with similar results. d, Human GBM ECs were transfected with siRNA targeting PAK4 or a random sequence. Nuclei extracts were immunoprecipitated using an anti-MEF2 antibody or a control antibody, followed by ChIP analysis of MEF2 binding to the ZEB1 promoter (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-way ANOVA. e, Human GBM-derived ECs were transfected with an siRNA that targets PAK4 or a random sequence. Nuclei extracts were analyzed for MEF2 transcriptional activity (n = 3 EC samples, each derived from a distinct human GBM tumor; means ± s.e.m.). Statistical significance was determined by two-tailed Student’s t-test.

Article Snippet: ECs were transfected with non-targeting control siRNA (Qiagen (1027280) or Thermo Fisher Scientific (AM4611)) or with siRNAs targeting Snail (Thermo Fisher Scientific; s13185), Slug (Thermo Fisher Scientific; s13127), ZEB1 (Thermo Fisher Scientific; s229971 or 4392420), MEF2D (Dharmacon; L-009884-00-0005), LEF1 (Dharmacon; L-015396-00-0005), PPAR-γ (Dharmacon; L-003436-00-0005) or PAK4 (Thermo Fisher Scientific; s20134 or 4390824) using RNAiMAX Lipofectamine (Invitrogen; 13778075) in serum-free Opti-MEM medium (Gibco; 31985-070) for 12 h, followed by incubation with serum-supplemented medium for 24 h. The guide RNA sequence (5′-GTGTTTGGGAAGAGGAAGAAG-3′) targeting PAK4 was subcloned into lentiCRISPRv2 puro vector (Addgene; 52961).

Techniques: Derivative Assay, RNA Sequencing, Multiplex Assay, Activity Assay, Transfection, Sequencing, Immunoprecipitation, Control, Binding Assay, Two Tailed Test

(A-B) E 2 induces Pak4 mRNA and protein levels. Serum-starved Ishikawa, RL95-2 and MCF-7 cells were treated with 10 nM E 2 , and cells were harvested at the indicated time. (A) The levels of Pak4 mRNA were determined by qRT-PCR, using β-actin as an internal control. Values represent mean ± s.d. (n = 3). *** P <0.001 compared with control. (B) The protein levels of Pak4 were assessed by Western blot. (C) Ishikawa and RL95-2 cells were serum-starved for 24 h, and then treated with 10 nM E 2 for indicated times. The levels of p-Pak4ser 474 were measured by Western blot, using β-actin as a loading control. All experiments were carried out in triplicates.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: (A-B) E 2 induces Pak4 mRNA and protein levels. Serum-starved Ishikawa, RL95-2 and MCF-7 cells were treated with 10 nM E 2 , and cells were harvested at the indicated time. (A) The levels of Pak4 mRNA were determined by qRT-PCR, using β-actin as an internal control. Values represent mean ± s.d. (n = 3). *** P <0.001 compared with control. (B) The protein levels of Pak4 were assessed by Western blot. (C) Ishikawa and RL95-2 cells were serum-starved for 24 h, and then treated with 10 nM E 2 for indicated times. The levels of p-Pak4ser 474 were measured by Western blot, using β-actin as a loading control. All experiments were carried out in triplicates.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Quantitative RT-PCR, Control, Western Blot

(A) Ishikawa and RL95-2 cells were treated with 10 nM E 2 for up to 90 min, and Western blot was used to detect p-AKT Ser 473 and total AKT levels. (B-C) RL95-2 cells were treated with E 2 for 60 or 90 min in the presence or absence of 20 μM LY 294002. Upper panel (B) p-AKT Ser 473 and (C) p-Pak4ser 474 levels were determined by western blotting, using β-actin as a loading control. Lower panel: Densitometric analysis of (B) p-AKT and (C) p-Pak4 in the immunoblots. Values represent mean ± s.d. (n = 3). * P < 0.05, *** P <0.001 compared with control, according to t-test. All experiments were carried out in triplicates.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: (A) Ishikawa and RL95-2 cells were treated with 10 nM E 2 for up to 90 min, and Western blot was used to detect p-AKT Ser 473 and total AKT levels. (B-C) RL95-2 cells were treated with E 2 for 60 or 90 min in the presence or absence of 20 μM LY 294002. Upper panel (B) p-AKT Ser 473 and (C) p-Pak4ser 474 levels were determined by western blotting, using β-actin as a loading control. Lower panel: Densitometric analysis of (B) p-AKT and (C) p-Pak4 in the immunoblots. Values represent mean ± s.d. (n = 3). * P < 0.05, *** P <0.001 compared with control, according to t-test. All experiments were carried out in triplicates.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Western Blot, Control

Immunofluorescence staining of (A) Pak4 and (B) p-Pak4 in RL95-2 cells treated with or without E 2 . Original magnification×400, bar=25μm. (C) Immunoblot analyses of Pak4 and p-Pak4 in subcellular protein fractions extracted from RL95-2 cells (T, total celllysate; C, cytoplasmic fraction; N, nuclear fraction). Cells were serum-starved for 24 h, and then treated with 10 nM E 2 , for indicated times.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: Immunofluorescence staining of (A) Pak4 and (B) p-Pak4 in RL95-2 cells treated with or without E 2 . Original magnification×400, bar=25μm. (C) Immunoblot analyses of Pak4 and p-Pak4 in subcellular protein fractions extracted from RL95-2 cells (T, total celllysate; C, cytoplasmic fraction; N, nuclear fraction). Cells were serum-starved for 24 h, and then treated with 10 nM E 2 , for indicated times.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Immunofluorescence, Staining, Western Blot

(A) Left: Protein and mRNA levels of Pak4 were measured in wt Pak4-overexpressing Ishikawa cells by Western blot and qRT-PCR analysis, respectively; Right: ERα mRNA levels detected by qRT-PCR. Values are the mean ± SD from at least three independent experiments. (B) Left: Western blot and qRT-PCR of Pak4 levels in two different shPak4-transfected RL95-2 cells. Right: ERα mRNA levels detected by qRT-PCR. Values are the mean ± SD from at least three independent experiments. (C) Ishikawa cells were stably transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. (D) RL95-2 cells were stably transfected with two different shPak4 or the control vector. The ERE-Luc reporter plasmids were transfected into Ishikawa and RL95-2 cells 24 h before E 2 treatment, and luciferase assay was performed 48 h after E 2 addition. The mRNA levels of ERα target genes were determined by qRT-PCR. Cells were treated with 10 nM E 2 or vehicle for 48 h before RNA extraction. Values represent mean ± s.d. (n = 3), from three independent experiments. * P < 0.05, ** P <0.01, *** P <0.001 compared with control, according to t-test. (E) Schematic representation of the estrogen response element and the primers used for ChIP–qPCR. ERE: estrogen response element. TSS: transcription start sites. (F-G) A summary of ChIP-qPCR results for ERα binding in RL95-2 cells with the primer pairs shown in (E) . (F) shPak4 and control vector transfected RL95-2 cellswere treated with 10 nM E 2 for 48 h before DNA extraction. (G) RL95-2 cells were treated with 10 nM E 2 in the presence or absence of 1μM PF 3758309.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: (A) Left: Protein and mRNA levels of Pak4 were measured in wt Pak4-overexpressing Ishikawa cells by Western blot and qRT-PCR analysis, respectively; Right: ERα mRNA levels detected by qRT-PCR. Values are the mean ± SD from at least three independent experiments. (B) Left: Western blot and qRT-PCR of Pak4 levels in two different shPak4-transfected RL95-2 cells. Right: ERα mRNA levels detected by qRT-PCR. Values are the mean ± SD from at least three independent experiments. (C) Ishikawa cells were stably transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. (D) RL95-2 cells were stably transfected with two different shPak4 or the control vector. The ERE-Luc reporter plasmids were transfected into Ishikawa and RL95-2 cells 24 h before E 2 treatment, and luciferase assay was performed 48 h after E 2 addition. The mRNA levels of ERα target genes were determined by qRT-PCR. Cells were treated with 10 nM E 2 or vehicle for 48 h before RNA extraction. Values represent mean ± s.d. (n = 3), from three independent experiments. * P < 0.05, ** P <0.01, *** P <0.001 compared with control, according to t-test. (E) Schematic representation of the estrogen response element and the primers used for ChIP–qPCR. ERE: estrogen response element. TSS: transcription start sites. (F-G) A summary of ChIP-qPCR results for ERα binding in RL95-2 cells with the primer pairs shown in (E) . (F) shPak4 and control vector transfected RL95-2 cellswere treated with 10 nM E 2 for 48 h before DNA extraction. (G) RL95-2 cells were treated with 10 nM E 2 in the presence or absence of 1μM PF 3758309.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Western Blot, Quantitative RT-PCR, Transfection, Stable Transfection, Control, Plasmid Preparation, Luciferase, RNA Extraction, ChIP-qPCR, Binding Assay, DNA Extraction

(A) Soft agar colony assays of Pak4 knockdown, Pak4 inhibitor PF 3758309 treated RL95-2 cells and control cells. Cells were cultured in the medium with or without E 2 for 2 weeks. (B) RL95-2 cells were transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. Cells were cultured in the medium with 10 nM E 2 and 100 nM ICI 182,780 for 2 weeks. Representative images (left) were captured with an inverted phase contrast microscope (magnification, ×200). Columns (right), represent the number of colonies from three independent experiments, each in triplicates; values represent mean ± s.d.; * P < 0.05, ** P <0.01, *** P <0.001. (C) RL95-2 cells were stably transfected with shPak4 or control vector with GFP. The fluorescence images showing the transfection efficiency, as well as the decreased size of colonies in Pak4 knockdown cells compared with control cells. Original magnification, ×400. (D) MTT assay of Pak4 knockdown, Pak4 inhibitor PF 3758309 treated RL95-2 cells and control cells. Cells were either treated with E 2 , vehicle or left untreated as indicated. (E) RL95-2 cells were transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. Cells were treated with 10 nM E 2 , 10 nM E 2 + 100 nM ICI 182,780, or vehicle as indicated. All experiments were carried out in triplicates. (F) Cell-cycle profiles of shPak4 RL95-2 cells were assessed by FACS using DNA content profiles (left). Cells were either treated with E 2 , vehicle, or left untreated for 96 h before measurement. The percentages of cells in each compartment were calculated (right). Values represent mean ± s.d. (n = 3). * P < 0.05, ** P <0.01 compared with control, according to t-test. All experiments were carried out in triplicates.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: (A) Soft agar colony assays of Pak4 knockdown, Pak4 inhibitor PF 3758309 treated RL95-2 cells and control cells. Cells were cultured in the medium with or without E 2 for 2 weeks. (B) RL95-2 cells were transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. Cells were cultured in the medium with 10 nM E 2 and 100 nM ICI 182,780 for 2 weeks. Representative images (left) were captured with an inverted phase contrast microscope (magnification, ×200). Columns (right), represent the number of colonies from three independent experiments, each in triplicates; values represent mean ± s.d.; * P < 0.05, ** P <0.01, *** P <0.001. (C) RL95-2 cells were stably transfected with shPak4 or control vector with GFP. The fluorescence images showing the transfection efficiency, as well as the decreased size of colonies in Pak4 knockdown cells compared with control cells. Original magnification, ×400. (D) MTT assay of Pak4 knockdown, Pak4 inhibitor PF 3758309 treated RL95-2 cells and control cells. Cells were either treated with E 2 , vehicle or left untreated as indicated. (E) RL95-2 cells were transfected with wt Pak4, ca Pak4, kinase-dead Pak4, or the control vector. Cells were treated with 10 nM E 2 , 10 nM E 2 + 100 nM ICI 182,780, or vehicle as indicated. All experiments were carried out in triplicates. (F) Cell-cycle profiles of shPak4 RL95-2 cells were assessed by FACS using DNA content profiles (left). Cells were either treated with E 2 , vehicle, or left untreated for 96 h before measurement. The percentages of cells in each compartment were calculated (right). Values represent mean ± s.d. (n = 3). * P < 0.05, ** P <0.01 compared with control, according to t-test. All experiments were carried out in triplicates.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Knockdown, Control, Cell Culture, Transfection, Plasmid Preparation, Microscopy, Stable Transfection, Fluorescence, MTT Assay

(A) Growth rates of tumors in nude mice inoculated with shPak4 RL95-2 cells or control cells. Values represent mean ± s.d. (n = 5). ** P <0.01 compared with control, according to t-test. (B) Immunohistochemical staining of Pak4 in control and shPak4 tumors.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: (A) Growth rates of tumors in nude mice inoculated with shPak4 RL95-2 cells or control cells. Values represent mean ± s.d. (n = 5). ** P <0.01 compared with control, according to t-test. (B) Immunohistochemical staining of Pak4 in control and shPak4 tumors.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Control, Immunohistochemical staining, Staining

Estrogen increases Pak4 expression and activation via PI3K/AKT pathway, the increased and activated Pak4 in turn enhances ERα transcriptional activity and cyclin D1 expression, which facilitates EC cell proliferation.

Journal: Oncotarget

Article Title: Cross-talk between p21-activated kinase 4 and ERα signaling triggers endometrial cancer cell proliferation

doi: 10.18632/oncotarget.19188

Figure Lengend Snippet: Estrogen increases Pak4 expression and activation via PI3K/AKT pathway, the increased and activated Pak4 in turn enhances ERα transcriptional activity and cyclin D1 expression, which facilitates EC cell proliferation.

Article Snippet: To stably silence Pak4 in RL95-2 cells, cells were transfected with two different shRNA constructs against human Pak4 or the control vector psiHIV-U6 (GeneCopoeia, Germantown, MD), and then selected with puromycin (0.5μg/mL, SIGMA Chemical, St Louis, MO, USA).

Techniques: Expressing, Activation Assay, Activity Assay